G1854905



Basic Information


Item Value
gene id G1854905
gene name NA
gene type unknown
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048587.1
NCBI id CM023241.2
chromosome length 62880378
location 31217597 ~ 31218171 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU2122867
tgatcactctggatgaactgcagagatctacagctgaggtgggagactctgtccataggacaacaatcagtcgtatattgcacaaatctggcctttatggaagagtggcaagaagaaagccttttcttaaagatatccataaaaagtgttgtttaaagtttgccacaagccacctgggagacacaccaaacatgtggaagaaggtgctctggtcagatgaaaccaaatttgaactttttggcaacaatgcaaaacattatgtttggcgtaaaagcaacacagctcatcaccctgaacacaccatccccattgtcaaacatggtggtggcagcatcatggtttgggcctgcttttcttcagcagggacagggaagatggttaaaattgatgggaagatggatgaagccaaatacaggaccattctggaagaacctgatggagtctgcaaaagacctgagactgggacggagatttgtcttccaacaagacaatgatccaaaacataaagcaaaatctacaatggaatggttcaaaaataaacatatccaggtgttagaatggccaagtcaaagtcc

Function


NR:

description
unnamed protein product, partial

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU2122867 True 575 TUCP 0.43 1 31217597 31218171
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110502571 LOC106608059 coding downstream 77065 31015540 ~ 31140532 (-)
LOC110502569 LOC106608004 coding downstream 207064 30908818 ~ 31010549 (-)
LOC110502567 rps27a coding downstream 382869 30826587 ~ 30834728 (-)
LOC110502562 LOC106607983 coding downstream 501440 30707821 ~ 30716157 (-)
LOC110502561 smek2 coding downstream 509980 30683457 ~ 30707617 (-)
LOC110502576 znt6 coding upstream 36900 31255071 ~ 31337901 (-)
LOC110503101 LOC106608102 coding upstream 205056 31423227 ~ 31437297 (-)
LOC110502582 NA coding upstream 301783 31519954 ~ 31557450 (-)
LOC110502583 LOC106608142 coding upstream 341643 31559814 ~ 31615144 (-)
LOC110502585 NA coding upstream 420480 31638651 ~ 31643143 (-)
G1854898 NA non-coding downstream 9364 31207994 ~ 31208233 (-)
G1854862 NA non-coding downstream 25928 31190980 ~ 31191669 (-)
G1854791 NA non-coding downstream 134952 31058297 ~ 31082645 (-)
G1854772 NA non-coding downstream 211547 31001046 ~ 31006050 (-)
G1854906 NA non-coding upstream 90 31218261 ~ 31218500 (-)
G1854919 NA non-coding upstream 14552 31232723 ~ 31233051 (-)
G1854925 NA non-coding upstream 25603 31243774 ~ 31243991 (-)
G1854926 NA non-coding upstream 26713 31244884 ~ 31245085 (-)
G1854929 NA non-coding upstream 30608 31248779 ~ 31248986 (-)
LOC110502574 LOC106608078 other downstream 28001 31151609 ~ 31239202 (-)
LOC110502553 NA other downstream 2285052 28919846 ~ 28932600 (-)
G1850441 NA other downstream 3139346 28074925 ~ 28078251 (-)
G1846858 NA other downstream 5777210 25439807 ~ 25440387 (-)
LOC110502462 LOC106607169 other downstream 7871826 23344353 ~ 23358461 (-)
G1855326 NA other upstream 761826 31979997 ~ 31981333 (-)
G1855821 NA other upstream 1296895 32515066 ~ 32515408 (-)
G1855822 LOC106608363 other upstream 1297578 32515749 ~ 32516281 (-)
G1856217 NA other upstream 1419254 32637425 ~ 32646140 (-)
LOC110502621 LOC106608559 other upstream 2377987 33590457 ~ 33601995 (-)

Expression


G1854905 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 2.
End of interactive chart.

G1854905 Expression in each Bioproject

Bar chart with 20 bars.
G1854905 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 60.
End of interactive chart.

Co-expression Network