G1853990



Basic Information


Item Value
gene id G1853990
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048587.1
NCBI id CM023241.2
chromosome length 62880378
location 32117306 ~ 32138022 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU2121882
tgggcgtgcaaaattattcagcccctttactttcattgcagcaaactctctccagaagttcagtgaggatctctgaatgatccaatgttgacctaaatgactaatgatgataaatacatgatgataaatcaagtctccgtataaatgcacctgcactgtgatagtctcagaggtccgttaaaagcgcagagagcatcatgaagaacaaggaacacaccaggcaggtcc

Function


NR:

description
unnamed protein product, partial

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU2121882 True 228 lncRNA 0.43 2 32117306 32138022
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110502597 LOC106608325 coding upstream 141270 31969957 ~ 31976036 (+)
LOC110503062 arhgef33 coding upstream 225773 31871734 ~ 31891533 (+)
morn2 morn2 coding upstream 247563 31866319 ~ 31869743 (+)
LOC110502586 LOC100196543 coding upstream 398356 31653358 ~ 31718950 (+)
LOC110502584 LOC106608814 coding upstream 493122 31620398 ~ 31624184 (+)
mrps5 LOC106608355 coding downstream 310764 32448786 ~ 32474652 (+)
LOC110502602 LOC106608363 coding downstream 351245 32489267 ~ 32530254 (+)
LOC110502603 LOC106608383 coding downstream 434424 32572446 ~ 32646173 (+)
LOC118943948 NA coding downstream 436819 32574841 ~ 32574893 (+)
LOC110502609 ppa1 coding downstream 845450 32983472 ~ 33000172 (+)
G1853966 NA non-coding upstream 36338 32080471 ~ 32080968 (+)
G1853944 LOC106608331 non-coding upstream 76831 32036230 ~ 32040475 (+)
G1853917 NA non-coding upstream 121453 31995651 ~ 31995853 (+)
G1853871 NA non-coding upstream 135087 31978665 ~ 31982219 (+)
G1853856 LOC106608247 non-coding upstream 215736 31900379 ~ 31901570 (+)
G1854048 NA non-coding downstream 70039 32208061 ~ 32208946 (+)
G1855502 NA non-coding downstream 117680 32255702 ~ 32256157 (+)
G1855527 NA non-coding downstream 139113 32277135 ~ 32277388 (+)
G1855559 NA non-coding downstream 162694 32300716 ~ 32300936 (+)
G1855571 LOC100136012 non-coding downstream 173743 32311765 ~ 32312163 (+)
G1853162 rps27a other upstream 1284863 30826585 ~ 30834692 (+)
G1853092 NA other upstream 1310852 30805550 ~ 30806454 (+)
LOC110502560 LOC106607954 other upstream 1464090 30547124 ~ 30659333 (+)
G1855733 NA other downstream 370216 32508238 ~ 32509474 (+)
G1855723 NA other downstream 380905 32518927 ~ 32519677 (+)
G1856094 LOC106577218 other downstream 799885 32937907 ~ 32942047 (+)
wnt8b LOC106608511 other downstream 1089811 33227748 ~ 33236137 (+)

Expression


G1853990 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 8.
End of interactive chart.

G1853990 Expression in each Bioproject

Bar chart with 15 bars.
G1853990 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 60.
End of interactive chart.

Co-expression Network