G1855405



Basic Information


Item Value
gene id G1855405
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048587.1
NCBI id CM023241.2
chromosome length 62880378
location 32117953 ~ 32138894 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU2123424
cttgcaaaacagctcgagctcagtgaggttggatggagagcatttgtgaacagcagttttcagttctttccacagattctcgattggattcaggtctggactttgacttggccattctaacacctggatatgtttatttttgaaccattccattgtagattttgctttatgttttggatcattgtcttgttggaagacaaatctccgtcccagtctcaggtcttttgctccaccattcttccagaatggtcctgtatttggctccatccatcttcccatcaattttaaccatcttccctgtccctgctgaagaaaagcaggcccaaaccatgatgctgccaccaccatgtttgacagtggggatggtgtgttcagctgtgttgcttttacgtcaaacataacgttttgcattgttgccaaaaagttcaattttggtttcatctgaccagag

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU2123424 True 451 lncRNA 0.43 2 32117953 32138894

Neighbor


gene id symbol gene type direction distance location
LOC110502599 NA coding downstream 133385 31982805 ~ 31984568 (-)
LOC110502596 LOC106608247 coding downstream 158507 31891979 ~ 31959446 (-)
LOC110503102 NA coding downstream 252017 31855932 ~ 31865936 (-)
galm galm coding downstream 263584 31831380 ~ 31854369 (-)
LOC110502589 hnrll coding downstream 300297 31762824 ~ 31817656 (-)
LOC110502604 LOC106608394 coding upstream 514441 32653335 ~ 32858193 (-)
LOC110502606 LOC102780737 coding upstream 799027 32937921 ~ 32944288 (-)
LOC110502608 eif4ebp2 coding upstream 830623 32969517 ~ 32975875 (-)
LOC110503103 LOC106608472 coding upstream 899776 33038670 ~ 33141219 (-)
dnajb12a LOC106608494 coding upstream 1014979 33153873 ~ 33166327 (-)
G1855316 NA non-coding downstream 157139 31960612 ~ 31960814 (-)
G1855255 NA non-coding downstream 226420 31891067 ~ 31891533 (-)
G1855285 NA non-coding downstream 232155 31885497 ~ 31885798 (-)
G1855284 NA non-coding downstream 232965 31884225 ~ 31884988 (-)
G1855516 NA non-coding upstream 131624 32270518 ~ 32270744 (-)
G1855525 NA non-coding upstream 136567 32275461 ~ 32275675 (-)
G1855533 NA non-coding upstream 142293 32281187 ~ 32281398 (-)
G1855610 NA non-coding upstream 206936 32345830 ~ 32346509 (-)
G1855612 NA non-coding upstream 207828 32346722 ~ 32347618 (-)
G1855326 NA other downstream 136620 31979997 ~ 31981333 (-)
G1854905 NA other downstream 899782 31217597 ~ 31218171 (-)
LOC110502574 LOC106608078 other downstream 928357 31151609 ~ 31239202 (-)
LOC110502553 NA other downstream 3185408 28919846 ~ 28932600 (-)
G1850441 NA other downstream 4039702 28074925 ~ 28078251 (-)
G1855821 NA other upstream 376172 32515066 ~ 32515408 (-)
G1855822 LOC106608363 other upstream 376855 32515749 ~ 32516281 (-)
G1856217 NA other upstream 498531 32637425 ~ 32646140 (-)
LOC110502621 LOC106608559 other upstream 1457264 33590457 ~ 33601995 (-)
kcnma1a LOC106613356 other upstream 2038163 34177056 ~ 34469529 (-)

Expression


G1855405 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 6.
End of interactive chart.

G1855405 Expression in each Bioproject

Bar chart with 21 bars.
G1855405 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 750.
End of interactive chart.

Co-expression Network