G1860463



Basic Information


Item Value
gene id G1860463
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048587.1
NCBI id CM023241.2
chromosome length 62880378
location 36447580 ~ 36448024 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU2128896
gagattcttcaaagtagccaccatttgccttgatgacagctttgcacaatcttggcattctctcaaccagcttcataaggtcacctggaatgcatttcaattaacaggtgtgccttgttaaaagttaatttgtggaatttctttccttcttaatgcatttgagccaatcagttgtgttgtgacaaggtaggggtggtatacagaagatagctctgtttggtaaaagaccaagtccatattatggcaagaacagctcaaaaaagctaagagaaatgacagtccatcattacttcaagacatgaaggtcagtcaatctggaaaatgtcaagtttcttcaattgcagtcgtaaaaaccatcaagagctatgatgaaactggctctcataaggaccgccacaggaaaggaagacccagagttgatgtacttctgctgcagaggataagt

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU2128896 True 445 lncRNA 0.40 1 36447580 36448024
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110502661 golga7b coding downstream 433122 35954220 ~ 36014458 (-)
LOC110503108 LOC106613040 coding downstream 846959 35545574 ~ 35600621 (-)
LOC110502653 LOC106613059 coding downstream 946630 35400833 ~ 35500950 (-)
LOC110502652 LOC106577244 coding downstream 1104752 35326690 ~ 35342828 (-)
LOC110502651 LOC106613069 coding downstream 1225494 35196193 ~ 35222086 (-)
marveld1 marveld1 coding upstream 180484 36628508 ~ 36629750 (-)
LOC110502666 LOC106612942 coding upstream 206127 36654151 ~ 36666245 (-)
LOC110502671 LOC106613549 coding upstream 344648 36792672 ~ 36794544 (-)
LOC110502672 nkx2-3 coding upstream 355363 36803387 ~ 36807411 (-)
LOC110502674 cnnm1 coding upstream 402100 36850124 ~ 36883088 (-)
G1860458 NA non-coding downstream 817 36446165 ~ 36446763 (-)
G1860306 NA non-coding downstream 235723 36211633 ~ 36211857 (-)
G1860304 NA non-coding downstream 237838 36209532 ~ 36209742 (-)
G1860293 NA non-coding downstream 250536 36196786 ~ 36197044 (-)
G1860288 NA non-coding downstream 254085 36193204 ~ 36193495 (-)
G1860475 NA non-coding upstream 14846 36462870 ~ 36463070 (-)
G1860486 NA non-coding upstream 21196 36469220 ~ 36469473 (-)
G1860575 NA non-coding upstream 97003 36545027 ~ 36545278 (-)
G1860876 NA non-coding upstream 242296 36690320 ~ 36691821 (-)
G1860894 NA non-coding upstream 277818 36725842 ~ 36726054 (-)
G1859038 NA other downstream 1203991 35243114 ~ 35243589 (-)
G1858636 NA other downstream 1478719 34936689 ~ 34968861 (-)
G1858575 LOC106613168 other downstream 1605918 34839900 ~ 34841662 (-)
G1858519 NA other downstream 1626015 34820776 ~ 34821565 (-)
G1860462 NA other upstream 807 36448831 ~ 36451459 (-)
G1861368 NA other upstream 887003 37335027 ~ 37335414 (-)
G1862272 NA other upstream 1708725 38156749 ~ 38157209 (-)
G1864033 NA other upstream 3001373 39449397 ~ 39453415 (-)
srsf2a LOC106612293 other upstream 3731805 40179809 ~ 40185223 (-)

Expression


G1860463 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 30.
End of interactive chart.

G1860463 Expression in each Bioproject

Bar chart with 20 bars.
G1860463 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 1000.
End of interactive chart.

Co-expression Network