G1860478



Basic Information


Item Value
gene id G1860478
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048587.1
NCBI id CM023241.2
chromosome length 62880378
location 36465211 ~ 36465522 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU2128912
cttcaaagtagccaccctatgccttgatgacagccttgcacactcttggcattctcccaaccagcttcatgaggttgtcacctggaatgcatttcaattaacaggtgtgccttgttaaaagttaatttgtggaatttctttccttcttaatgcgtttgagccaatcagttgtgttgtgacaaggtaggggtggtatacagaagatagccctattttgtaaaagaccaagtccatattacggcaagaacagctcaaataagcaaagagaaattacagtccatcattactttaagacatgaaggtcagtcaata

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU2128912 True 312 lncRNA 0.40 1 36465211 36465522

Neighbor


gene id symbol gene type direction distance location
LOC110503110 LOC106612973 coding upstream 74154 36264498 ~ 36391057 (+)
sfrp5 sfrp5 coding upstream 302659 36123204 ~ 36166009 (+)
crtac1b crtac1 coding upstream 530214 35879332 ~ 35934997 (+)
loxl4 loxl4 coding upstream 650510 35757462 ~ 35814701 (+)
zgc:123010 LOC106613015 coding upstream 729519 35687052 ~ 35735692 (+)
LOC110502664 avpi1 coding downstream 177598 36643120 ~ 36647796 (+)
LOC110502667 LOC105021389 coding downstream 216373 36681895 ~ 36692480 (+)
LOC110502668 LOC106612941 coding downstream 229047 36591861 ~ 36714947 (+)
LOC110502670 slc25a28 coding downstream 279455 36744977 ~ 36763280 (+)
LOC110502673 got1 coding downstream 358362 36823884 ~ 36850022 (+)
G1860476 NA non-coding upstream 1091 36463900 ~ 36464120 (+)
G1860460 NA non-coding upstream 17350 36447583 ~ 36447861 (+)
G1859655 NA non-coding upstream 18502 36446264 ~ 36446709 (+)
G1859741 NA non-coding upstream 56764 36408202 ~ 36408447 (+)
G1859740 NA non-coding upstream 57170 36407615 ~ 36408041 (+)
G1860576 NA non-coding downstream 80525 36546047 ~ 36546302 (+)
G1860621 NA non-coding downstream 275574 36741096 ~ 36743829 (+)
G1860687 NA non-coding downstream 300578 36766100 ~ 36767774 (+)
G1860694 NA non-coding downstream 311153 36776675 ~ 36776937 (+)
G1859436 NA other upstream 438225 35954168 ~ 36026986 (+)
G1859175 NA other upstream 1048110 35416512 ~ 35417101 (+)
G1857923 NA other upstream 1647075 34817749 ~ 34818136 (+)
G1860679 NA other downstream 258550 36724072 ~ 36724509 (+)
LOC110502696 LOC106613523 other downstream 1572527 38038007 ~ 38067483 (+)
LOC110502720 mpc1 other downstream 2983881 39449355 ~ 39458454 (+)
G1863919 NA other downstream 3147482 39613004 ~ 39613630 (+)
LOC110502740 LOC106613508 other downstream 3382292 39847791 ~ 39850264 (+)

Expression


G1860478 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 100.
End of interactive chart.

G1860478 Expression in each Bioproject

Bar chart with 21 bars.
G1860478 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 4000.
End of interactive chart.

Co-expression Network