G1860703



Basic Information


Item Value
gene id G1860703
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048587.1
NCBI id CM023241.2
chromosome length 62880378
location 36791755 ~ 36792072 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU2129150
GTTTTTAAACCTAGAATGTTTAGATTTTAGAATGTCGGTGATTCAATTTAGTTACTTGTAGTCTTCAAGAGCTCGACCATGGGCTAATAATAACCATGTTCAAACGCATTACGTCCTCATTAGTGCAACGTCTTTTGCATCGTCATGTTGTGTAAGTTTTCTGTTCACATATTGTGGGTTCAACTTCTAACAGGCAGCTAAATGCAGAAACAATGCAGATATTATTGGTACTTATATTGTGTCTGCCATGATGAAATTCGTTATCAATCCTTATGAATGTTTTGAAAAAATCCCACAATATTTTGAAATCCATATATT

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU2129150 True 318 lncRNA 0.34 1 36791755 36792072

Neighbor


gene id symbol gene type direction distance location
LOC110502670 slc25a28 coding upstream 28475 36744977 ~ 36763280 (+)
LOC110502668 LOC106612941 coding upstream 76808 36591861 ~ 36714947 (+)
LOC110502667 LOC105021389 coding upstream 99275 36681895 ~ 36692480 (+)
LOC110502664 avpi1 coding upstream 143959 36643120 ~ 36647796 (+)
LOC110503110 LOC106612973 coding upstream 400698 36264498 ~ 36391057 (+)
LOC110502673 got1 coding downstream 31812 36823884 ~ 36850022 (+)
hpse2 hpse2 coding downstream 96360 36888432 ~ 37002537 (+)
hps1 hps1 coding downstream 215453 37007525 ~ 37029828 (+)
wu:fc17b08 LOC106612867 coding downstream 287893 37079965 ~ 37125397 (+)
LOC110502682 LOC106612832 coding downstream 572253 37364325 ~ 37492607 (+)
G1860702 NA non-coding upstream 946 36790572 ~ 36790809 (+)
G1860694 NA non-coding upstream 14818 36776675 ~ 36776937 (+)
G1860687 NA non-coding upstream 23981 36766100 ~ 36767774 (+)
G1860621 NA non-coding upstream 47926 36741096 ~ 36743829 (+)
G1860713 NA non-coding downstream 15352 36807424 ~ 36811369 (+)
G1860721 NA non-coding downstream 31434 36823506 ~ 36823724 (+)
G1860726 NA non-coding downstream 41878 36833950 ~ 36836584 (+)
G1860729 NA non-coding downstream 52896 36844968 ~ 36845924 (+)
G1860739 NA non-coding downstream 80605 36872677 ~ 36874695 (+)
G1860679 NA other upstream 67246 36724072 ~ 36724509 (+)
G1859436 NA other upstream 764769 35954168 ~ 36026986 (+)
crtac1b crtac1 other upstream 858543 35879332 ~ 35934997 (+)
G1859175 NA other upstream 1374654 35416512 ~ 35417101 (+)
LOC110502696 LOC106613523 other downstream 1245977 38038007 ~ 38067483 (+)
LOC110502720 mpc1 other downstream 2657331 39449355 ~ 39458454 (+)
G1863919 NA other downstream 2820932 39613004 ~ 39613630 (+)
LOC110502740 LOC106613508 other downstream 3055742 39847791 ~ 39850264 (+)
G1864291 NA other downstream 3058584 39850656 ~ 39853367 (+)

Expression


G1860703 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 1.
End of interactive chart.

G1860703 Expression in each Bioproject

Bar chart with 6 bars.
G1860703 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 6.
End of interactive chart.

Co-expression Network