G1862272



Basic Information


Item Value
gene id G1862272
gene name NA
gene type unknown
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048587.1
NCBI id CM023241.2
chromosome length 62880378
location 38156749 ~ 38157209 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU2130947
ggatgagtacaaccccaagaacactatcccaactgtgaagcatggaggtggaaacatcattctttggagatgcttttctgcaaaggggacaggacgactgcaccgtattgaggggaggatggatggggccatgtatcgcgatatcttggccaacaacctccttccctcagtaagagcattgaagatgggccgtggctgggtcttccagcatgacaacgacccgaaacacacagccagggcaactaaggagtggctccgtaagaagcatctcaaggtcctggattggcctagccagtctccagacctgaacccaatagaaaatctttggagggagctgaaaatccgtattgcccagcgacagccccgaaacctgaaggatctggagaaggtctgtatggaggagtgggccaaaatccctgctgcagtgtgtgcaaacctggtcaagaactacaggaaatgta

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU2130947 True 461 TUCP 0.52 1 38156749 38157209
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110502698 LOC106612663 coding downstream 56157 38082120 ~ 38100592 (-)
LOC110502689 LOC106612792 coding downstream 464553 37682673 ~ 37692196 (-)
LOC110502685 LOC106612807 coding downstream 490437 37662065 ~ 37666312 (-)
prim2 prim2 coding downstream 506785 37542585 ~ 37649964 (-)
si:dkey-103j14.5 LOC106612836 coding downstream 802725 37339267 ~ 37354024 (-)
LOC110502699 LOC106612641 coding upstream 20272 38177481 ~ 38187671 (-)
LOC110502701 LOC106612630 coding upstream 34976 38192185 ~ 38271406 (-)
LOC110503074 NA coding upstream 130597 38287806 ~ 38304066 (-)
LOC110502706 fbx9 coding upstream 251674 38408883 ~ 38416607 (-)
LOC110502709 LOC106589793 coding upstream 281790 38438531 ~ 38451320 (-)
G1862271 NA non-coding downstream 127 38156394 ~ 38156622 (-)
G1862250 NA non-coding downstream 20844 38135631 ~ 38135905 (-)
G1862213 NA non-coding downstream 48318 38108169 ~ 38108431 (-)
G1862209 NA non-coding downstream 51654 38104880 ~ 38105095 (-)
G1862204 NA non-coding downstream 53302 38103223 ~ 38103447 (-)
G1862274 NA non-coding upstream 722 38157931 ~ 38158223 (-)
G1862289 NA non-coding upstream 11219 38168428 ~ 38168630 (-)
G1862607 NA non-coding upstream 122568 38279777 ~ 38280015 (-)
G1862608 NA non-coding upstream 123459 38280668 ~ 38280910 (-)
G1862611 NA non-coding upstream 125222 38282431 ~ 38282686 (-)
G1861368 NA other downstream 821335 37335027 ~ 37335414 (-)
G1860462 NA other downstream 1705290 36448831 ~ 36451459 (-)
LOC110502661 golga7b other downstream 2197544 35954220 ~ 36014458 (-)
G1859038 NA other downstream 2913160 35243114 ~ 35243589 (-)
G1858636 NA other downstream 3187888 34936689 ~ 34968861 (-)
G1864033 NA other upstream 1292188 39449397 ~ 39453415 (-)
srsf2a LOC106612293 other upstream 2022620 40179809 ~ 40185223 (-)
G1868010 NA other upstream 4758197 42915406 ~ 42978144 (-)
G1868940 LOC106611807 other upstream 5329659 43486868 ~ 43501433 (-)
G1872165 NA other upstream 7870711 46027920 ~ 46029807 (-)

Expression


G1862272 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 3.
End of interactive chart.

G1862272 Expression in each Bioproject

Bar chart with 19 bars.
G1862272 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 60.
End of interactive chart.

Co-expression Network