G1871399



Basic Information


Item Value
gene id G1871399
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048587.1
NCBI id CM023241.2
chromosome length 62880378
location 44559623 ~ 44564516 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU2140910
tgctggaccgtgcgctgattgatgatttcctccgttgccgccaggcttcctcctcgagtgcgccaggaggcgctcggtgagtgggggggtactgtcatgtactgtcatgttgtcttgtctctgtcctttcccttcaccctgtctccctctgctggtcgtgttaggttaccttttctcccccgctttcccccagctgtcccttgtctcctctaactacccattcaccccgttccccacc
>TU2140913
tgctggaccgtgcgctgattgatgatttcctccgttgccgccaggtttcctcctcgagtgcgccaggaggcgctcggtgagtggggggggtatgtcatgtactgtcatgttgtcttgtctctgtcctttcccttcaccctgtctccctctgctggtcgtgttaggttaccttttctcccccgctttcccccagctgtcccttgtctcctctaactacccattcaccccgttccccacc

Function


GO: NA

KEGG:

id description

RNA


RNA id representative length rna type GC content exon number start site end site
TU2140910 False 238 lncRNA 0.58 2 44559623 44564516
TU2140913 True 238 lncRNA 0.58 2 44559623 44564516
Loading

Neighbor


gene id symbol gene type direction distance location
LOC100301649 LOC106611671 coding downstream 51094 44300058 ~ 44508529 (-)
LOC110502816 LOC106611732 coding downstream 548674 44008133 ~ 44010949 (-)
LOC110502811 dusp13 coding downstream 657070 43877678 ~ 43902553 (-)
dusp29 LOC106611804 coding downstream 683742 43873977 ~ 43875881 (-)
LOC110502805 LOC106611817 coding downstream 1125884 43408822 ~ 43433739 (-)
LOC110502821 LOC106611643 coding upstream 92442 44656958 ~ 44687275 (-)
LOC110502822 LOC106611598 coding upstream 129559 44694075 ~ 44736553 (-)
snx5 LOC106611592 coding upstream 194019 44758535 ~ 44773318 (-)
si:dkey-76k16.6 LOC106613470 coding upstream 213388 44777904 ~ 44789403 (-)
LOC100136752 LOC100136752 coding upstream 234271 44798787 ~ 44801437 (-)
G1871394 NA non-coding downstream 7619 44549880 ~ 44552004 (-)
G1871390 NA non-coding downstream 18048 44541117 ~ 44541575 (-)
LOC110503120 LOC106611651 non-coding downstream 37213 44521978 ~ 44646297 (-)
G1871381 NA non-coding downstream 42156 44517228 ~ 44517467 (-)
G1871379 NA non-coding downstream 44807 44514617 ~ 44514816 (-)
G1871408 NA non-coding upstream 21536 44586052 ~ 44586638 (-)
G1871366 NA non-coding upstream 57301 44621817 ~ 44626347 (-)
G1871471 NA non-coding upstream 90555 44655071 ~ 44655308 (-)
G1871490 NA non-coding upstream 178165 44742681 ~ 44742896 (-)
G1871497 NA non-coding upstream 188207 44752723 ~ 44752975 (-)
G1868940 LOC106611807 other downstream 1058190 43486868 ~ 43501433 (-)
G1868010 NA other downstream 1581479 42915406 ~ 42978144 (-)
srsf2a LOC106612293 other downstream 4374411 40179809 ~ 40185223 (-)
G1864033 NA other downstream 5106208 39449397 ~ 39453415 (-)
G1862272 NA other downstream 6402414 38156749 ~ 38157209 (-)
G1872165 NA other upstream 1463404 46027920 ~ 46029807 (-)
G1872556 NA other upstream 2232719 46797235 ~ 46797650 (-)
G1873030 NA other upstream 2376770 46941286 ~ 46942457 (-)
G1873043 NA other upstream 2396106 46960622 ~ 46961653 (-)
LOC110502870 PHF5A other upstream 2503392 47067897 ~ 47079813 (-)

Expression


G1871399 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 30.
End of interactive chart.

G1871399 Expression in each Bioproject

Bar chart with 17 bars.
G1871399 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 300.
End of interactive chart.

Co-expression Network