G1871490



Basic Information


Item Value
gene id G1871490
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048587.1
NCBI id CM023241.2
chromosome length 62880378
location 44742681 ~ 44742896 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU2141016
acatgaacaaactaacaaaaacaagaaatgtgaaaacgcaaaacagtcctatcctgtgacaacaaacacagtgacaggaacaatcacccacaaacacacagtgaaacccaggctacctaagtatgattctcaatcagagacaactaatgacaccggcctctgattgagaaccatactaggccgaaaacatagaaatgccccaaaacatagaaaaac

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU2141016 True 216 lncRNA 0.40 1 44742681 44742896
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110502822 LOC106611598 coding downstream 6128 44694075 ~ 44736553 (-)
LOC110502821 LOC106611643 coding downstream 55406 44656958 ~ 44687275 (-)
LOC110503120 LOC106611651 coding downstream 96384 44521978 ~ 44646297 (-)
LOC100301649 LOC106611671 coding downstream 234152 44300058 ~ 44508529 (-)
LOC110502816 LOC106611732 coding downstream 731732 44008133 ~ 44010949 (-)
snx5 LOC106611592 coding upstream 15639 44758535 ~ 44773318 (-)
si:dkey-76k16.6 LOC106613470 coding upstream 35008 44777904 ~ 44789403 (-)
LOC100136752 LOC100136752 coding upstream 55891 44798787 ~ 44801437 (-)
LOC110502826 mad2l1bp coding upstream 63420 44806316 ~ 44810370 (-)
macrod2 macrod2 coding upstream 233432 44976328 ~ 46166935 (-)
G1871471 NA non-coding downstream 87373 44655071 ~ 44655308 (-)
G1871366 NA non-coding downstream 116334 44621817 ~ 44626347 (-)
G1871408 NA non-coding downstream 156043 44586052 ~ 44586638 (-)
G1871400 NA non-coding downstream 173604 44559461 ~ 44569077 (-)
G1871399 NA non-coding downstream 178165 44559623 ~ 44564516 (-)
G1871497 NA non-coding upstream 9827 44752723 ~ 44752975 (-)
G1871501 NA non-coding upstream 11476 44754372 ~ 44754608 (-)
G1871503 NA non-coding upstream 14973 44757869 ~ 44758168 (-)
G1871504 NA non-coding upstream 22402 44765298 ~ 44765612 (-)
G1871508 NA non-coding upstream 32741 44775637 ~ 44775998 (-)
G1868940 LOC106611807 other downstream 1241248 43486868 ~ 43501433 (-)
G1868010 NA other downstream 1764537 42915406 ~ 42978144 (-)
srsf2a LOC106612293 other downstream 4557469 40179809 ~ 40185223 (-)
G1864033 NA other downstream 5289266 39449397 ~ 39453415 (-)
G1862272 NA other downstream 6585472 38156749 ~ 38157209 (-)
G1872165 NA other upstream 1285024 46027920 ~ 46029807 (-)
G1872556 NA other upstream 2054339 46797235 ~ 46797650 (-)
G1873030 NA other upstream 2198390 46941286 ~ 46942457 (-)
G1873043 NA other upstream 2217726 46960622 ~ 46961653 (-)
LOC110502870 PHF5A other upstream 2325012 47067897 ~ 47079813 (-)

Expression


G1871490 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 6.
End of interactive chart.

G1871490 Expression in each Bioproject

Bar chart with 12 bars.
G1871490 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 25.
End of interactive chart.

Co-expression Network