G1873996



Basic Information


Item Value
gene id G1873996
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048587.1
NCBI id CM023241.2
chromosome length 62880378
location 48152547 ~ 48152759 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU2143924
CGGACTTCCCCAGGACATTGTCTCAGATCGTGGGCCCCAGTTCGTCGCACGGAATTGGAAATCCTTCTGGGGGCGTCAGTGAGTCTCTCCTCTGGATTCCACCCACAGTCGAATGGCCAACCAGGAGCTGGAGAATTTCCCCCGCTGTTTCATTTCCACCAAGGCCAGCAACTGGAGCCCGTTCCTCGTCTGGGTGAAGAATGCTCACCCCCC

Function


NR:

description
PREDICTED: uncharacterized protein LOC102214915

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU2143924 True 213 lncRNA 0.58 1 48152547 48152759
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110502894 LOC106609588 coding downstream 73062 48040588 ~ 48079485 (-)
LOC110502890 LOC106609275 coding downstream 263236 47801102 ~ 47889311 (-)
LOC110502884 LOC106589545 coding downstream 694538 47450667 ~ 47458009 (-)
LOC110502880 LOC106609454 coding downstream 898112 47232147 ~ 47254435 (-)
trnar-ccu-55 NA coding downstream 962759 47189716 ~ 47189788 (-)
LOC110502896 rhbl4 coding upstream 4952 48157711 ~ 48289997 (-)
LOC110502897 LOC106609622 coding upstream 208647 48361406 ~ 48372720 (-)
LOC110502900 NA coding upstream 227835 48380366 ~ 48387106 (-)
LOC110503131 LOC106609649 coding upstream 290710 48443469 ~ 48475356 (-)
LOC110502901 NA coding upstream 367927 48520679 ~ 48528302 (-)
G1873975 NA non-coding downstream 14966 48137338 ~ 48137581 (-)
G1873972 NA non-coding downstream 17464 48134840 ~ 48135083 (-)
G1873962 NA non-coding downstream 24663 48127593 ~ 48127884 (-)
G1873951 NA non-coding downstream 29115 48117425 ~ 48123432 (-)
G1873948 NA non-coding downstream 40522 48111811 ~ 48112025 (-)
G1874225 NA non-coding upstream 47066 48199825 ~ 48235054 (-)
G1874235 NA non-coding upstream 104149 48256908 ~ 48257146 (-)
G1874236 NA non-coding upstream 104481 48257240 ~ 48257448 (-)
G1874207 NA non-coding upstream 189875 48342634 ~ 48343270 (-)
G1874274 NA non-coding upstream 224640 48377399 ~ 48378918 (-)
G1873183 NA other downstream 892614 47257593 ~ 47312395 (-)
LOC110502870 PHF5A other downstream 1072757 47067897 ~ 47079813 (-)
G1873043 NA other downstream 1190894 46960622 ~ 46961653 (-)
G1873030 NA other downstream 1210090 46941286 ~ 46942457 (-)
G1872556 NA other downstream 1354897 46797235 ~ 46797650 (-)
LOC110503133 LOC106609742 other upstream 485232 48637596 ~ 48641914 (-)
LOC110502911 LOC106609787 other upstream 576853 48729606 ~ 48838648 (-)
G1875310 NA other upstream 1151760 49304519 ~ 49307135 (-)
LOC110503141 LOC106610139 other upstream 1628853 49732121 ~ 49855083 (-)

Expression


G1873996 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 3.
End of interactive chart.

G1873996 Expression in each Bioproject

Bar chart with 8 bars.
G1873996 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 10.
End of interactive chart.

Co-expression Network