G1874671



Basic Information


Item Value
gene id G1874671
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048587.1
NCBI id CM023241.2
chromosome length 62880378
location 49076372 ~ 49077562 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU2144711
tggacagtctgtggtgcaacgtggcgttggtggatggagcgagacatgatgtcccagatgtgctcaattggattcaggtctggggaacgggcgggccagtccatagcagcaatgccttcctcttgcaggaactgctgacacactccagccacatgaggtctagcattgtcttgcattaggaggaacccagggccaaccgcaccagcatatggtctcacaaggggtctgaggatctcatctcggtacctaatggcagtcaggctacctctggcgagcacatggagggctgtgaggccccccaaagaaatgccaccccacaccataactgaccctccgccaaaccggtcatgctggaggatgttgcaggcagcagaacgttctccacggcgtctccagactgtcacgtctgtcacatgtgctcagtgtgaacctgctttcatctgtgaagagcacagggcaccagtggcgaatttgccaatcttggtgttctctggcaaatgaaaaacgtcctgcacggtgttgggctgtaagcacaacccccacctgtggacgtcgggccctcataccaccctcatggagtctgtttctgaccgtttgagcagacacatgcacatttgtggcctgctggaggtcattttgcagtgctctggcagtgctcctcctgctactccttgcacaaaggcggaggtagtggtcctgctgctgggttgttgccctcctacggcctcctccacgtctcctgatgtactggcctgtctcctggtagcacctccatgctctggacactacgctgacagacacagcaaaccttcttgccacagctcgcattgatgttccatcctggatgagctgcactacctgagccacttgtgtgggttgtagactccgtctcatgctaccaatagagtgaaagcaccgccagcattcaaaagtgaccaaaacatcagccaggaagcataggaactgagaagtggtctgtggtccccacctgcagaaccactcctttattgggggtgtcttgctaattgcctataatttcgacctgttgtctattccatttgcacaacagcatgtgaaatgtattgtcaatcagtgttgcttcctaagtggacagtttgatttcacagaagtgtgattgacttggagttacattgtgttgtttaagtgttccctttatttttttgagcagtg

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU2144711 True 1191 lncRNA 0.53 1 49076372 49077562
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110502906 LOC106609750 coding upstream 361365 48699649 ~ 48715007 (+)
LOC110502908 LOC106609766 coding upstream 376338 48696420 ~ 48700034 (+)
LOC110503132 LOC106609704 coding upstream 554569 48517879 ~ 48521803 (+)
LOC110503066 pgp coding upstream 561575 48513541 ~ 48514797 (+)
LOC110502898 LOC106609288 coding upstream 636112 48388000 ~ 48440260 (+)
LOC110503137 LOC106609807 coding downstream 86440 49164002 ~ 49217265 (+)
LOC110502913 LOC106609825 coding downstream 139911 49217473 ~ 49243566 (+)
LOC110502915 LOC106609864 coding downstream 220082 49297644 ~ 49300486 (+)
LOC110502916 LOC106609875 coding downstream 227050 49304612 ~ 49307131 (+)
LOC110502917 LOC106610070 coding downstream 239189 49316751 ~ 49326031 (+)
G1874668 NA non-coding upstream 3750 49072246 ~ 49072622 (+)
G1874667 NA non-coding upstream 6575 49069597 ~ 49069797 (+)
G1874654 NA non-coding upstream 23601 49052281 ~ 49052771 (+)
G1874653 NA non-coding upstream 24128 49051908 ~ 49052244 (+)
G1874650 NA non-coding upstream 28251 49047847 ~ 49048121 (+)
G1874717 NA non-coding downstream 78716 49156278 ~ 49156542 (+)
G1874719 NA non-coding downstream 81527 49159089 ~ 49159324 (+)
G1875109 NA non-coding downstream 203994 49281556 ~ 49282460 (+)
G1875136 NA non-coding downstream 255999 49333561 ~ 49333767 (+)
G1875142 NA non-coding downstream 263371 49340933 ~ 49341866 (+)
G1873717 LOC106609588 other upstream 1033540 48040594 ~ 48042832 (+)
LOC110502893 LOC106609573 other upstream 1059889 48007176 ~ 48021129 (+)
LOC110502887 NA other upstream 1605569 47467771 ~ 47470803 (+)
LOC110502882 csnk1d other upstream 1688681 47374444 ~ 47435736 (+)
LOC110503127 LOC106609422 other upstream 1751593 47312009 ~ 47374126 (+)
G1875567 NA other downstream 675526 49753088 ~ 49753438 (+)
G1875689 LOC100136012 other downstream 971624 50049186 ~ 50050036 (+)
G1875816 NA other downstream 1165998 50243560 ~ 50244524 (+)
G1876374 Rpl38 other downstream 1688537 50766099 ~ 50770263 (+)
G1877363 NA other downstream 2381145 51458707 ~ 51459345 (+)

Expression


G1874671 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 15.
End of interactive chart.

G1874671 Expression in each Bioproject

Bar chart with 21 bars.
G1874671 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 600.
End of interactive chart.

Co-expression Network