G1879083



Basic Information


Item Value
gene id G1879083
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048587.1
NCBI id CM023241.2
chromosome length 62880378
location 53213340 ~ 53213586 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU2149570
ttttaaagcttccagtctgttattcgaactcaatcagcatgacaaagtgatctccagccttgtcctcgtcaacactcacacctgtgttaacgagagaatcactgacatgatgtcagctggtccttttgtggaagggttgaaatgcagtggaaatgttttggggggattcagttcatttgcatggcaaatagggactttgcaattaattgcaattcatctgatcactcttcataacattctggagtat

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU2149570 True 247 lncRNA 0.41 1 53213340 53213586
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110502959 LOC106610521 coding upstream 439848 52767090 ~ 52773492 (+)
LOC110502958 LOC106610530 coding upstream 625452 52525574 ~ 52587888 (+)
LOC110503031 LOC106583559 coding upstream 1237229 51956172 ~ 52016294 (+)
LOC110502954 LOC106610563 coding upstream 1452387 51725830 ~ 51760953 (+)
LOC110503029 LOC106610476 coding upstream 1503935 51312874 ~ 51709405 (+)
LOC118943904 NA coding downstream 184598 53398184 ~ 53400297 (+)
LOC110502965 dll1 coding downstream 437725 53651311 ~ 53657432 (+)
LOC110502967 psmb1 coding downstream 537780 53751366 ~ 53753611 (+)
tbp tbp coding downstream 557769 53771355 ~ 53780114 (+)
LOC110502970 LOC106610710 coding downstream 570494 53784080 ~ 53792095 (+)
G1879074 NA non-coding upstream 7616 53205455 ~ 53205724 (+)
G1879067 NA non-coding upstream 21131 53190943 ~ 53192209 (+)
G1879066 NA non-coding upstream 23134 53189976 ~ 53190206 (+)
G1879065 NA non-coding upstream 25203 53187553 ~ 53188137 (+)
G1879064 NA non-coding upstream 26634 53186173 ~ 53186706 (+)
G1879559 NA non-coding downstream 146827 53360413 ~ 53360624 (+)
G1879588 NA non-coding downstream 166825 53380411 ~ 53380644 (+)
G1879590 NA non-coding downstream 168524 53382110 ~ 53382456 (+)
G1879599 NA non-coding downstream 177314 53390900 ~ 53391116 (+)
G1878894 LOC106610502 other upstream 352705 52857868 ~ 52860635 (+)
G1878893 NA other upstream 376706 52825488 ~ 52836634 (+)
G1878346 LOC100136012 other upstream 987151 52225820 ~ 52226189 (+)
G1877363 NA other upstream 1753995 51458707 ~ 51459345 (+)
G1879582 NA other downstream 164224 53377810 ~ 53378186 (+)
G1879958 NA other downstream 638085 53851671 ~ 53855730 (+)
G1881371 NA other downstream 1789196 55002782 ~ 55003672 (+)
G1882830 NA other downstream 3316209 56529795 ~ 56538483 (+)

Expression


G1879083 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 6.
End of interactive chart.

G1879083 Expression in each Bioproject

Bar chart with 19 bars.
G1879083 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 150.
End of interactive chart.

Co-expression Network