G1879582



Basic Information


Item Value
gene id G1879582
gene name NA
gene type unknown
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048587.1
NCBI id CM023241.2
chromosome length 62880378
location 53377810 ~ 53378186 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU2150101
gtaatggtccaggttacaaagtggctcagtgactcgtgtttgcatctcaatgtgaaaaaaactgtttgcatgttcttcacaaagagggcaacagatgctactgagccagatgtctatgtgtcaggggagaagctccaggtggtatccgattttaagtaccttggcatcatacttgattccaaactctcttttaaaaagcatgtgaaaaaggtaattcaaataaccaaattcaacctagctaatttccgatttatacgaaattgtttgactacagaggtagcaaaactgtacttcaaatctatgatactcccccacttaacatactgcttgactagttgggcccaagcttgctatacaacattaaaacctattcagtc

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU2150101 True 377 TUCP 0.39 1 53377810 53378186

Neighbor


gene id symbol gene type direction distance location
LOC110502959 LOC106610521 coding upstream 604318 52767090 ~ 52773492 (+)
LOC110502958 LOC106610530 coding upstream 789922 52525574 ~ 52587888 (+)
LOC110503031 LOC106583559 coding upstream 1401699 51956172 ~ 52016294 (+)
LOC110502954 LOC106610563 coding upstream 1616857 51725830 ~ 51760953 (+)
LOC110503029 LOC106610476 coding upstream 1668405 51312874 ~ 51709405 (+)
LOC118943904 NA coding downstream 19998 53398184 ~ 53400297 (+)
LOC110502965 dll1 coding downstream 273125 53651311 ~ 53657432 (+)
LOC110502967 psmb1 coding downstream 373180 53751366 ~ 53753611 (+)
tbp tbp coding downstream 393169 53771355 ~ 53780114 (+)
LOC110502970 LOC106610710 coding downstream 405894 53784080 ~ 53792095 (+)
G1879559 NA non-coding upstream 17186 53360413 ~ 53360624 (+)
G1879083 NA non-coding upstream 164224 53213340 ~ 53213586 (+)
G1879074 NA non-coding upstream 172086 53205455 ~ 53205724 (+)
G1879067 NA non-coding upstream 185601 53190943 ~ 53192209 (+)
G1879066 NA non-coding upstream 187604 53189976 ~ 53190206 (+)
G1879588 NA non-coding downstream 2225 53380411 ~ 53380644 (+)
G1879590 NA non-coding downstream 3924 53382110 ~ 53382456 (+)
G1879599 NA non-coding downstream 12714 53390900 ~ 53391116 (+)
G1879605 NA non-coding downstream 24243 53402429 ~ 53403165 (+)
G1878894 LOC106610502 other upstream 517175 52857868 ~ 52860635 (+)
G1878893 NA other upstream 541176 52825488 ~ 52836634 (+)
G1878346 LOC100136012 other upstream 1151621 52225820 ~ 52226189 (+)
G1877363 NA other upstream 1918465 51458707 ~ 51459345 (+)
G1879958 NA other downstream 473485 53851671 ~ 53855730 (+)
G1881371 NA other downstream 1624596 55002782 ~ 55003672 (+)
G1882830 NA other downstream 3151609 56529795 ~ 56538483 (+)
G1882831 NA other downstream 3155431 56533617 ~ 56543256 (+)

Expression


G1879582 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 12.
End of interactive chart.

G1879582 Expression in each Bioproject

Bar chart with 20 bars.
G1879582 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 300.
End of interactive chart.

Co-expression Network