G1879654



Basic Information


Item Value
gene id G1879654
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048587.1
NCBI id CM023241.2
chromosome length 62880378
location 53443285 ~ 53443598 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU2150188
ttgtttctggccattttgagcctataatcgaacccacaaatgctgatgctccagatactcaactagtctaaagaaggccagctttattgcttctttaatcaggacaacagttttcagctgtgctaacataattgcaaaagggttttctaatgatcaattagccttttaaaagtatcaacttggattagttaacacaacgtgccattggaacacaggagtgatggttgctgataatggacctctgtacgcctatgtagatattctataaaaaatctgctgtttccagcaacaatagtcatttacaacattaacaa

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU2150188 True 314 lncRNA 0.37 1 53443285 53443598
Loading

Neighbor


gene id symbol gene type direction distance location
LOC118943904 NA coding upstream 42988 53398184 ~ 53400297 (+)
LOC110502959 LOC106610521 coding upstream 669793 52767090 ~ 52773492 (+)
LOC110502958 LOC106610530 coding upstream 855397 52525574 ~ 52587888 (+)
LOC110503031 LOC106583559 coding upstream 1467174 51956172 ~ 52016294 (+)
LOC110502954 LOC106610563 coding upstream 1682332 51725830 ~ 51760953 (+)
LOC110502965 dll1 coding downstream 207713 53651311 ~ 53657432 (+)
LOC110502967 psmb1 coding downstream 307768 53751366 ~ 53753611 (+)
tbp tbp coding downstream 327757 53771355 ~ 53780114 (+)
LOC110502970 LOC106610710 coding downstream 340482 53784080 ~ 53792095 (+)
LOC110502971 LOC106610715 coding downstream 385693 53829291 ~ 53840691 (+)
G1879608 NA non-coding upstream 39005 53403927 ~ 53404280 (+)
G1879605 NA non-coding upstream 40120 53402429 ~ 53403165 (+)
G1879599 NA non-coding upstream 52169 53390900 ~ 53391116 (+)
G1879590 NA non-coding upstream 60829 53382110 ~ 53382456 (+)
G1879686 NA non-coding downstream 42854 53486452 ~ 53492000 (+)
G1879688 NA non-coding downstream 43793 53487391 ~ 53487918 (+)
G1879829 NA non-coding downstream 158098 53601696 ~ 53601899 (+)
G1879832 NA non-coding downstream 160907 53604505 ~ 53604715 (+)
G1879849 NA non-coding downstream 171346 53614944 ~ 53615377 (+)
G1879582 NA other upstream 65099 53377810 ~ 53378186 (+)
G1878894 LOC106610502 other upstream 582650 52857868 ~ 52860635 (+)
G1878893 NA other upstream 606651 52825488 ~ 52836634 (+)
G1878346 LOC100136012 other upstream 1217096 52225820 ~ 52226189 (+)
G1879958 NA other downstream 408073 53851671 ~ 53855730 (+)
G1881371 NA other downstream 1559184 55002782 ~ 55003672 (+)
G1882830 NA other downstream 3086197 56529795 ~ 56538483 (+)
G1882831 NA other downstream 3090019 56533617 ~ 56543256 (+)
LOC110503001 LOC106611028 other downstream 3229650 56613066 ~ 56727194 (+)

Expression


G1879654 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 15.
End of interactive chart.

G1879654 Expression in each Bioproject

Bar chart with 18 bars.
G1879654 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 400.
End of interactive chart.

Co-expression Network