G1879832



Basic Information


Item Value
gene id G1879832
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048587.1
NCBI id CM023241.2
chromosome length 62880378
location 53604505 ~ 53604715 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU2150382
TATGTGACAAAAAGAGCTTATGCTGCAACAATGCAAGTTCTGTCCTTACACTGATCACACGAGACCACAGTCGAAGGCAACTTTCCTTGAATTTCTGTTTTGTACGTTGAATGACATCATCCCCACCAGCCTGTCATTTTATCTTTGGCTGTTTCATTCAGTTAGTTCACAGCGTTTCAGCAAGCCACAGCTGCAACTCATAGCTATACCC

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU2150382 True 211 lncRNA 0.43 1 53604505 53604715

Neighbor


gene id symbol gene type direction distance location
LOC118943904 NA coding upstream 204208 53398184 ~ 53400297 (+)
LOC110502959 LOC106610521 coding upstream 831013 52767090 ~ 52773492 (+)
LOC110502958 LOC106610530 coding upstream 1016617 52525574 ~ 52587888 (+)
LOC110503031 LOC106583559 coding upstream 1628394 51956172 ~ 52016294 (+)
LOC110502954 LOC106610563 coding upstream 1843552 51725830 ~ 51760953 (+)
LOC110502965 dll1 coding downstream 46596 53651311 ~ 53657432 (+)
LOC110502967 psmb1 coding downstream 146651 53751366 ~ 53753611 (+)
tbp tbp coding downstream 166640 53771355 ~ 53780114 (+)
LOC110502970 LOC106610710 coding downstream 179365 53784080 ~ 53792095 (+)
LOC110502971 LOC106610715 coding downstream 224576 53829291 ~ 53840691 (+)
G1879829 NA non-coding upstream 2606 53601696 ~ 53601899 (+)
G1879686 NA non-coding upstream 112505 53486452 ~ 53492000 (+)
G1879688 NA non-coding upstream 116587 53487391 ~ 53487918 (+)
G1879654 NA non-coding upstream 160907 53443285 ~ 53443598 (+)
G1879608 NA non-coding upstream 200225 53403927 ~ 53404280 (+)
G1879849 NA non-coding downstream 10229 53614944 ~ 53615377 (+)
G1879856 NA non-coding downstream 20683 53625398 ~ 53625642 (+)
G1879876 NA non-coding downstream 36465 53641180 ~ 53705440 (+)
G1879896 NA non-coding downstream 61677 53666392 ~ 53666790 (+)
G1879928 NA non-coding downstream 110364 53715079 ~ 53715309 (+)
G1879582 NA other upstream 226319 53377810 ~ 53378186 (+)
G1878894 LOC106610502 other upstream 743870 52857868 ~ 52860635 (+)
G1878893 NA other upstream 767871 52825488 ~ 52836634 (+)
G1878346 LOC100136012 other upstream 1378316 52225820 ~ 52226189 (+)
G1879958 NA other downstream 246956 53851671 ~ 53855730 (+)
G1881371 NA other downstream 1398067 55002782 ~ 55003672 (+)
G1882830 NA other downstream 2925080 56529795 ~ 56538483 (+)
G1882831 NA other downstream 2928902 56533617 ~ 56543256 (+)
LOC110503001 LOC106611028 other downstream 3068533 56613066 ~ 56727194 (+)

Expression


G1879832 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 3.
End of interactive chart.

G1879832 Expression in each Bioproject

Bar chart with 1 bar.
G1879832 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 25.
End of interactive chart.

Co-expression Network