G1879935 (phf10)


Basic Information

Item Value
gene id G1879935
gene name phf10
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information

Item Value
chromosome id NC_048587.1
NCBI id CM023241.2
chromosome length 62880378
location 53727250 ~ 53734631 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence

>TU2150502
CCCTCAGATATAGCTTCTCCTTGTGGGAGAGGTCTCTCCTTTCCAAATCTGGATATTTTCGCTTGAATGAAGTGACTCCCAGATATTCACTGACTTGTTCTTGTAACATATAGTACTCCCCACTACCGTCTGACGGCCACCTGTACTCGGTGAGATTTTCTGCTGAGAAGTATGTGGGCCCAAGTTCCTGACTGGAGGTGTCGCAACTTCTGGAACTGTCACCTGAACCCATGCGCTGTCTTTTTGGAGCTTGACTGCCATCATTGGACACTTCCTCGATGTCATCCTTTACAGACTGAGCTCCCGGGGTTGCAGGGTTGCTATCGCAAGGTCTGGTTGGGAGAACAGTAGCCATGTTTAGCGGTTACTGTCCTGTTAGCTTCAGAGATGCACACCAGGATAATAATGTTACCGACTGGAAACAGAGACAAGGAACAAATCTTCTTCAAGTGGCGGTAACATGGGGAATACATGTTTGCCAACATTGGCTACATCGTACAAATTCATGAAAATAAAAGTGTGCTTTTAGGTCTTAATTTAAGGGTTCGGCAAAAGGTTTGCAGTGTGGTTGAGGTTATG

Function

symbol description
phf10 Predicted to enable histone binding activity and transcription coregulator activity. Predicted to be involved in negative regulation of transcription, DNA-templated and positive regulation of transcription by RNA polymerase II. Predicted to act upstream of or within nervous system development. Predicted to be located in nucleus. Predicted to be part of npBAF complex. Orthologous to human PHF10 (PHD finger protein 10).

NR:

description
PHD finger protein 10-like

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU2150502 True 579 lncRNA 0.46 4 53727250 53734631
Loading

Neighbor

gene id symbol gene type direction distance location
LOC110502965 dll1 coding upstream 69818 53651311 ~ 53657432 (+)
LOC118943904 NA coding upstream 326953 53398184 ~ 53400297 (+)
LOC110502959 LOC106610521 coding upstream 953758 52767090 ~ 52773492 (+)
LOC110502958 LOC106610530 coding upstream 1139362 52525574 ~ 52587888 (+)
LOC110503031 LOC106583559 coding upstream 1751139 51956172 ~ 52016294 (+)
LOC110502967 psmb1 coding downstream 16735 53751366 ~ 53753611 (+)
tbp tbp coding downstream 36724 53771355 ~ 53780114 (+)
LOC110502970 LOC106610710 coding downstream 49449 53784080 ~ 53792095 (+)
LOC110502971 LOC106610715 coding downstream 94660 53829291 ~ 53840691 (+)
LOC110503035 urb2 coding downstream 134064 53868695 ~ 53893092 (+)
G1879929 NA non-coding upstream 3082 53721479 ~ 53724168 (+)
G1879928 NA non-coding upstream 11941 53715079 ~ 53715309 (+)
G1879876 NA non-coding upstream 21810 53641180 ~ 53705440 (+)
G1879896 NA non-coding upstream 60460 53666392 ~ 53666790 (+)
G1879856 NA non-coding upstream 101608 53625398 ~ 53625642 (+)
G1879945 NA non-coding downstream 9512 53744143 ~ 53744584 (+)
G1879956 NA non-coding downstream 21371 53756002 ~ 53756242 (+)
G1879968 NA non-coding downstream 28823 53763454 ~ 53763655 (+)
G1879969 NA non-coding downstream 29770 53764401 ~ 53764713 (+)
G1879977 NA non-coding downstream 62638 53797269 ~ 53797575 (+)
G1879582 NA other upstream 349064 53377810 ~ 53378186 (+)
G1878894 LOC106610502 other upstream 866615 52857868 ~ 52860635 (+)
G1878893 NA other upstream 890616 52825488 ~ 52836634 (+)
G1878346 LOC100136012 other upstream 1501061 52225820 ~ 52226189 (+)
G1879958 NA other downstream 117040 53851671 ~ 53855730 (+)
G1881371 NA other downstream 1268151 55002782 ~ 55003672 (+)
G1882830 NA other downstream 2795164 56529795 ~ 56538483 (+)
G1882831 NA other downstream 2798986 56533617 ~ 56543256 (+)
LOC110503001 LOC106611028 other downstream 2938617 56613066 ~ 56727194 (+)

Expression

G1879935(phf10) Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 4.
End of interactive chart.

G1879935(phf10) Expression in each Bioproject

Bar chart with 11 bars.
G1879935(phf10) Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 12.
End of interactive chart.

Co-expression Network