G1879977



Basic Information


Item Value
gene id G1879977
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048587.1
NCBI id CM023241.2
chromosome length 62880378
location 53797269 ~ 53797575 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU2150557
tacgtacggtcactgtggggacaacgtcatcaatgcacttattgatgaagccaatgactgatgtggtgtactcctcaatgccatcggaagaatcccggaacatgttccagtctgtgctagcaaaacagtcctgtagcttagcatctgcttcatctgaccactttttaattgatctagtcactggtgcttcctgcttaaattgttttgcttgtaagcaggaatccggaggatagaattatggtcagatttgtcaaatggagggcgagggagagctttgtatgcatctctgtgtgtggagtaaaggtgg

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU2150557 True 307 lncRNA 0.45 1 53797269 53797575

Neighbor


gene id symbol gene type direction distance location
LOC110502970 LOC106610710 coding upstream 5174 53784080 ~ 53792095 (+)
tbp tbp coding upstream 17155 53771355 ~ 53780114 (+)
LOC110502967 psmb1 coding upstream 43658 53751366 ~ 53753611 (+)
LOC110502965 dll1 coding upstream 139837 53651311 ~ 53657432 (+)
LOC118943904 NA coding upstream 396972 53398184 ~ 53400297 (+)
LOC110502971 LOC106610715 coding downstream 31716 53829291 ~ 53840691 (+)
LOC110503035 urb2 coding downstream 71120 53868695 ~ 53893092 (+)
LOC110502975 galt2 coding downstream 104866 53902441 ~ 54027929 (+)
LOC110502976 LOC106610750 coding downstream 276781 54074356 ~ 54097821 (+)
LOC110503037 LOC106610766 coding downstream 316138 54113713 ~ 54190405 (+)
G1879969 NA non-coding upstream 32556 53764401 ~ 53764713 (+)
G1879968 NA non-coding upstream 33614 53763454 ~ 53763655 (+)
G1879956 NA non-coding upstream 41027 53756002 ~ 53756242 (+)
G1879945 NA non-coding upstream 52685 53744143 ~ 53744584 (+)
G1879935 phf10 non-coding upstream 62638 53727250 ~ 53734631 (+)
G1879980 NA non-coding downstream 3462 53801037 ~ 53804872 (+)
G1879983 NA non-coding downstream 11985 53809560 ~ 53809896 (+)
G1879998 NA non-coding downstream 27483 53825058 ~ 53825364 (+)
G1880009 NA non-coding downstream 44401 53841976 ~ 53843302 (+)
G1880002 NA non-coding downstream 46658 53844233 ~ 53847002 (+)
G1879582 NA other upstream 419083 53377810 ~ 53378186 (+)
G1878894 LOC106610502 other upstream 936634 52857868 ~ 52860635 (+)
G1878893 NA other upstream 960635 52825488 ~ 52836634 (+)
G1878346 LOC100136012 other upstream 1571080 52225820 ~ 52226189 (+)
G1879958 NA other downstream 54096 53851671 ~ 53855730 (+)
G1881371 NA other downstream 1205207 55002782 ~ 55003672 (+)
G1882830 NA other downstream 2732220 56529795 ~ 56538483 (+)
G1882831 NA other downstream 2736042 56533617 ~ 56543256 (+)
LOC110503001 LOC106611028 other downstream 2875673 56613066 ~ 56727194 (+)

Expression


G1879977 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 20.
End of interactive chart.

G1879977 Expression in each Bioproject

Bar chart with 20 bars.
G1879977 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 600.
End of interactive chart.

Co-expression Network