G1881018



Basic Information


Item Value
gene id G1881018
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048587.1
NCBI id CM023241.2
chromosome length 62880378
location 54653424 ~ 54653661 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU2151827
atcatatgacccactgaagagatgagtcttcagtagagacttaaaggttgagaccgagtttgcgtctctgacatgggtaggcagaccgttccataaaaaaggagctctataggagaaagccctgcctccagctgtttgcttagaaattctagggacaattaggaggcctgcgtcttgtgaccgtagcgtacatgtaggtatgtacggcaggaccaaatcagagagataggtacagtgc

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU2151827 True 238 lncRNA 0.47 1 54653424 54653661
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110502983 LOC106610821 coding upstream 43063 54593361 ~ 54610361 (+)
si:ch73-52p7.1 NA coding upstream 180445 54471595 ~ 54472979 (+)
LOC110502981 LOC106610814 coding upstream 191018 54428818 ~ 54462406 (+)
LOC110502979 LOC106610787 coding upstream 291003 54329710 ~ 54362634 (+)
LOC110503037 LOC106610766 coding upstream 463019 54113713 ~ 54190405 (+)
LOC110502989 LOC106610853 coding downstream 41214 54694875 ~ 54728124 (+)
LOC118943891 NA coding downstream 296873 54950534 ~ 54962738 (+)
LOC110502992 LOC106610889 coding downstream 417527 55071188 ~ 55169539 (+)
dync2li1 dync2li1 coding downstream 519382 55173043 ~ 55182204 (+)
LOC110502997 LOC106610965 coding downstream 1281544 55935205 ~ 55938585 (+)
G1880999 perp non-coding upstream 16337 54634884 ~ 54637087 (+)
G1880358 NA non-coding upstream 126640 54526368 ~ 54526784 (+)
G1880355 NA non-coding upstream 129868 54522950 ~ 54523556 (+)
G1880338 NA non-coding upstream 184574 54468625 ~ 54468850 (+)
G1880332 NA non-coding upstream 204809 54447143 ~ 54448615 (+)
G1881020 NA non-coding downstream 1694 54655355 ~ 54656212 (+)
G1881111 NA non-coding downstream 88855 54742516 ~ 54742900 (+)
G1881113 NA non-coding downstream 89578 54743239 ~ 54743466 (+)
G1881136 NA non-coding downstream 115463 54769124 ~ 54769721 (+)
G1881184 NA non-coding downstream 179046 54832707 ~ 54836690 (+)
G1879958 NA other upstream 797694 53851671 ~ 53855730 (+)
LOC118943904 NA other upstream 1253137 53398184 ~ 53400297 (+)
G1879582 NA other upstream 1275238 53377810 ~ 53378186 (+)
G1878894 LOC106610502 other upstream 1792789 52857868 ~ 52860635 (+)
G1878893 NA other upstream 1816790 52825488 ~ 52836634 (+)
G1881371 NA other downstream 349121 55002782 ~ 55003672 (+)
G1882830 NA other downstream 1876134 56529795 ~ 56538483 (+)
G1882831 NA other downstream 1879956 56533617 ~ 56543256 (+)
LOC110503001 LOC106611028 other downstream 2019587 56613066 ~ 56727194 (+)
G1883457 NA other downstream 2358376 57012037 ~ 57013218 (+)

Expression


G1881018 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 10.
End of interactive chart.

G1881018 Expression in each Bioproject

Bar chart with 18 bars.
G1881018 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 300.
End of interactive chart.

Co-expression Network