G1881289



Basic Information


Item Value
gene id G1881289
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048587.1
NCBI id CM023241.2
chromosome length 62880378
location 54937836 ~ 54938563 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU2152163
gccatagtagtatggtaggtgcagtgaattgtgttgttttacagggtcagccatagtagtatgataggtgcagtgaattgtgttgttttacagggtcagccatagtagtatgataggtgcagtgtaatgtgttgttttacagggtcagccatagtagtatgataggtgcagtgaattgtgttgttttacagggtcagccatagtagtatgataggtacagtgaattgtgttgttttac

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU2152163 True 238 lncRNA 0.40 2 54937836 54938563
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110502989 LOC106610853 coding upstream 209712 54694875 ~ 54728124 (+)
LOC110502983 LOC106610821 coding upstream 327475 54593361 ~ 54610361 (+)
si:ch73-52p7.1 NA coding upstream 464857 54471595 ~ 54472979 (+)
LOC110502981 LOC106610814 coding upstream 475430 54428818 ~ 54462406 (+)
LOC110502979 LOC106610787 coding upstream 575415 54329710 ~ 54362634 (+)
LOC118943891 NA coding downstream 11971 54950534 ~ 54962738 (+)
LOC110502992 LOC106610889 coding downstream 132625 55071188 ~ 55169539 (+)
dync2li1 dync2li1 coding downstream 234480 55173043 ~ 55182204 (+)
LOC110502997 LOC106610965 coding downstream 996642 55935205 ~ 55938585 (+)
LOC110502999 NA coding downstream 1046980 55985543 ~ 56041354 (+)
G1881276 NA non-coding upstream 17785 54919736 ~ 54920051 (+)
G1881269 NA non-coding upstream 32101 54905497 ~ 54905735 (+)
G1881267 NA non-coding upstream 32915 54904611 ~ 54904921 (+)
G1881265 NA non-coding upstream 33677 54901938 ~ 54904159 (+)
G1881262 NA non-coding upstream 51330 54886185 ~ 54886506 (+)
G1881296 NA non-coding downstream 4065 54942628 ~ 54942866 (+)
G1881304 NA non-coding downstream 9419 54947982 ~ 54948217 (+)
G1881311 NA non-coding downstream 13986 54952549 ~ 54952774 (+)
G1881344 NA non-coding downstream 39257 54977820 ~ 54978044 (+)
G1881369 NA non-coding downstream 62291 55000854 ~ 55042043 (+)
G1879958 NA other upstream 1082106 53851671 ~ 53855730 (+)
LOC118943904 NA other upstream 1537549 53398184 ~ 53400297 (+)
G1879582 NA other upstream 1559650 53377810 ~ 53378186 (+)
G1878894 LOC106610502 other upstream 2077201 52857868 ~ 52860635 (+)
G1878893 NA other upstream 2101202 52825488 ~ 52836634 (+)
G1881371 NA other downstream 64219 55002782 ~ 55003672 (+)
G1882830 NA other downstream 1591232 56529795 ~ 56538483 (+)
G1882831 NA other downstream 1595054 56533617 ~ 56543256 (+)
LOC110503001 LOC106611028 other downstream 1734685 56613066 ~ 56727194 (+)
G1883457 NA other downstream 2073474 57012037 ~ 57013218 (+)

Expression


G1881289 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 15.
End of interactive chart.

G1881289 Expression in each Bioproject

Bar chart with 10 bars.
G1881289 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 250.
End of interactive chart.

Co-expression Network