G1881478



Basic Information


Item Value
gene id G1881478
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048587.1
NCBI id CM023241.2
chromosome length 62880378
location 55093885 ~ 55094183 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU2152379
caatgatccaaaacataaagaaaatctacaatggaatgtttcaaaaataaacatattcaggtgttagaatggccaagtcaaagtccagacctgaatccaatcgagaatctgtggaaagaactgaaaactgctgttcacaaatgctctccatccaacctcactgagctcgagctgttttgcaaggaatgggaaaaaatgtcagtctctcgatgtgcaaaactgatagagacataccccaagcgacttacagctgtaatcgcagcaaaaggtggcgctacaaagtattaacttaagggggc

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU2152379 True 299 lncRNA 0.41 1 55093885 55094183
Loading

Neighbor


gene id symbol gene type direction distance location
LOC118943891 NA coding upstream 131147 54950534 ~ 54962738 (+)
LOC110502989 LOC106610853 coding upstream 365761 54694875 ~ 54728124 (+)
LOC110502983 LOC106610821 coding upstream 483524 54593361 ~ 54610361 (+)
si:ch73-52p7.1 NA coding upstream 620906 54471595 ~ 54472979 (+)
LOC110502981 LOC106610814 coding upstream 631479 54428818 ~ 54462406 (+)
dync2li1 dync2li1 coding downstream 78860 55173043 ~ 55182204 (+)
LOC110502997 LOC106610965 coding downstream 841022 55935205 ~ 55938585 (+)
LOC110502999 NA coding downstream 891360 55985543 ~ 56041354 (+)
LOC110503000 prkce coding downstream 1217457 56311640 ~ 56610758 (+)
LOC110503001 LOC106611028 coding downstream 1518883 56613066 ~ 56727194 (+)
G1881476 NA non-coding upstream 1351 55092333 ~ 55092534 (+)
G1881475 NA non-coding upstream 1813 55091831 ~ 55092072 (+)
G1881412 NA non-coding upstream 24440 55068912 ~ 55069445 (+)
G1881369 NA non-coding upstream 51842 55000854 ~ 55042043 (+)
G1881344 NA non-coding upstream 115841 54977820 ~ 54978044 (+)
G1881482 NA non-coding downstream 3419 55097602 ~ 55097830 (+)
G1881488 NA non-coding downstream 13586 55107769 ~ 55108064 (+)
G1881489 NA non-coding downstream 14510 55108693 ~ 55108892 (+)
G1881490 NA non-coding downstream 15695 55109878 ~ 55110090 (+)
G1881493 NA non-coding downstream 28989 55123172 ~ 55123487 (+)
G1881371 NA other upstream 90213 55002782 ~ 55003672 (+)
G1879958 NA other upstream 1238155 53851671 ~ 53855730 (+)
LOC118943904 NA other upstream 1693598 53398184 ~ 53400297 (+)
G1879582 NA other upstream 1715699 53377810 ~ 53378186 (+)
G1878894 LOC106610502 other upstream 2233250 52857868 ~ 52860635 (+)
G1882830 NA other downstream 1435612 56529795 ~ 56538483 (+)
G1882831 NA other downstream 1439434 56533617 ~ 56543256 (+)
G1883457 NA other downstream 1917854 57012037 ~ 57013218 (+)
G1885587 NA other downstream 3768031 58862214 ~ 58864502 (+)

Expression


G1881478 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 5.
End of interactive chart.

G1881478 Expression in each Bioproject

Bar chart with 14 bars.
G1881478 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 50.
End of interactive chart.

Co-expression Network