G1881579



Basic Information


Item Value
gene id G1881579
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048587.1
NCBI id CM023241.2
chromosome length 62880378
location 55137093 ~ 55137391 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU2152491
GGAGTAAACACACCATGGTCTTTCCTGCCTTCTCTCCTGTCTGACTGCCTACAGGAGGAGTAAACACACCATGGTCTTTCCTGCCTTCTCTCCTGTCTGACTGCCTACAGGAGGAGTAAACAGGCCATGGTCTTTCCTGCCTTCTCTCCTGTCTGACTGCCTACAGGAGGAGTAAACACACCATGGTCTTTCCTACCTTCTCTCCTGTCTGACTGCCTACAGGAGGAGTAAACACACCATGGTCTTTCCTGCCTTCTCTCCTGTCTGACTGCCTACAGGAGGAGTAAACACACCATGGT

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU2152491 True 299 lncRNA 0.52 1 55137093 55137391
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110502991 NA coding downstream 65947 55068829 ~ 55071146 (-)
LOC110502990 LOC106610860 coding downstream 369428 54756179 ~ 54767665 (-)
LOC110502987 cssa01h1orf101 coding downstream 442751 54677565 ~ 54694342 (-)
LOC118943819 NA coding downstream 475333 54660257 ~ 54661760 (-)
LOC110502984 perp coding downstream 489145 54634879 ~ 54647948 (-)
LOC110502996 LOC107666370 coding upstream 53079 55190470 ~ 55204193 (-)
LOC110502998 LOC106610959 coding upstream 843876 55981267 ~ 55984852 (-)
LOC110503038 NA coding upstream 906940 56044331 ~ 56059595 (-)
LOC110503002 LOC106610976 coding upstream 1622688 56760079 ~ 56780244 (-)
LOC110503005 LOC106611007 coding upstream 1719189 56856580 ~ 56886643 (-)
G1881578 NA non-coding downstream 437 55136371 ~ 55136656 (-)
G1881577 LOC106610889 non-coding downstream 1060 55135577 ~ 55136033 (-)
G1881576 NA non-coding downstream 1778 55135079 ~ 55135315 (-)
G1881571 NA non-coding downstream 28474 55108260 ~ 55108619 (-)
G1881560 NA non-coding downstream 42910 55093904 ~ 55094183 (-)
G1881580 NA non-coding upstream 1277 55138668 ~ 55139051 (-)
G1881581 NA non-coding upstream 2274 55139665 ~ 55139973 (-)
G1881583 LOC106610889 non-coding upstream 5481 55142872 ~ 55143317 (-)
G1881585 NA non-coding upstream 7912 55145303 ~ 55145566 (-)
G1881601 LOC106610889 non-coding upstream 30191 55167582 ~ 55169458 (-)
G1881414 NA other downstream 133469 55002766 ~ 55003624 (-)
G1880780 NA other downstream 890407 54244782 ~ 54246686 (-)
LOC110503036 LOC106610742 other downstream 1063144 54039018 ~ 54073953 (-)
G1879406 NA other downstream 1972742 53163242 ~ 53164351 (-)
G1878770 NA other downstream 2493584 52643088 ~ 52643509 (-)
G1883219 NA other upstream 1468615 56606006 ~ 56610640 (-)
G1883244 NA other upstream 1506616 56644007 ~ 56709888 (-)
LOC110503007 LOC106586972 other upstream 1974742 57071327 ~ 57116725 (-)
LOC110503041 LOC106579580 other upstream 2452653 57590001 ~ 57616121 (-)
G1884227 NA other upstream 2596966 57734357 ~ 57735498 (-)

Expression


G1881579 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 1.5.
End of interactive chart.

G1881579 Expression in each Bioproject

Bar chart with 7 bars.
G1881579 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 60.
End of interactive chart.

Co-expression Network