G1881749


Basic Information

Item Value
gene id G1881749
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information

Item Value
chromosome id NC_048587.1
NCBI id CM023241.2
chromosome length 62880378
location 55347060 ~ 55376669 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence

>TU2152678
atgtattatagtacacaccactctcatctccatgtagtatagtacacaccactctcatctccatgtattttagtacacaccactctcatctccatgtagtatagtacacaccactctcatctcaatgcattatagtacacaccactctcatctccatgtagtatagtacacaccactctcatctccatgtagaatagtacacaccactctcatctccatatgttttagtacacaccactctcatctccatgtactattataaatacgactctcatctccatgtattatagtacacaccactcacatctccatgtgttatagtacacaccactctcatctccatgtattatagtacacaccactctcatctccatgtattatagtacacaccactctcatctccgtgtattatagtacacaccactctcatctccatgtagtatagtacacaccactctcatctccatgtattttagtacacaccactctcatctccatgtagtatagtacacaccactctcatctccatgtagtatagtacacaccactctcatctccatgtattatagtacacaccactctcatctccatgtagcatagtacacaccactctcatctccatgtattatagtacacaccactctcatctc

Function

NR:

description
PREDICTED: uncharacterized protein LOC106592987

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU2152678 True 650 lncRNA 0.40 2 55347060 55376669
Loading

Neighbor

gene id symbol gene type direction distance location
dync2li1 dync2li1 coding upstream 164856 55173043 ~ 55182204 (+)
LOC110502992 LOC106610889 coding upstream 177521 55071188 ~ 55169539 (+)
LOC118943891 NA coding upstream 384322 54950534 ~ 54962738 (+)
LOC110502989 LOC106610853 coding upstream 618936 54694875 ~ 54728124 (+)
LOC110502983 LOC106610821 coding upstream 736699 54593361 ~ 54610361 (+)
LOC110502997 LOC106610965 coding downstream 558536 55935205 ~ 55938585 (+)
LOC110502999 NA coding downstream 608874 55985543 ~ 56041354 (+)
LOC110503000 prkce coding downstream 934971 56311640 ~ 56610758 (+)
LOC110503001 LOC106611028 coding downstream 1236397 56613066 ~ 56727194 (+)
LOC118943924 NA coding downstream 1326062 56701366 ~ 56709966 (+)
G1881698 NA non-coding upstream 60874 55285906 ~ 55286186 (+)
G1881693 NA non-coding upstream 70657 55276175 ~ 55276403 (+)
G1881692 NA non-coding upstream 71939 55274917 ~ 55275121 (+)
G1881672 NA non-coding upstream 90706 55256109 ~ 55256354 (+)
G1881535 NA non-coding upstream 128467 55217230 ~ 55218593 (+)
G1881821 NA non-coding downstream 55101 55431770 ~ 55432040 (+)
G1881853 NA non-coding downstream 78101 55454770 ~ 55455093 (+)
G1881873 NA non-coding downstream 97495 55474164 ~ 55474393 (+)
G1881881 NA non-coding downstream 113228 55489897 ~ 55490132 (+)
G1881893 NA non-coding downstream 144125 55520794 ~ 55521624 (+)
G1881371 NA other upstream 343388 55002782 ~ 55003672 (+)
G1879958 NA other upstream 1491330 53851671 ~ 53855730 (+)
LOC118943904 NA other upstream 1946773 53398184 ~ 53400297 (+)
G1879582 NA other upstream 1968874 53377810 ~ 53378186 (+)
G1878894 LOC106610502 other upstream 2486425 52857868 ~ 52860635 (+)
G1882830 NA other downstream 1153126 56529795 ~ 56538483 (+)
G1882831 NA other downstream 1156948 56533617 ~ 56543256 (+)
G1883457 NA other downstream 1635368 57012037 ~ 57013218 (+)
G1885587 NA other downstream 3485545 58862214 ~ 58864502 (+)

Expression

G1881749 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 4.
End of interactive chart.

G1881749 Expression in each Bioproject

Bar chart with 5 bars.
G1881749 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 70.
End of interactive chart.

Co-expression Network