G1883457



Basic Information


Item Value
gene id G1883457
gene name NA
gene type unknown
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048587.1
NCBI id CM023241.2
chromosome length 62880378
location 57012037 ~ 57013218 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU2154622
acctacaaccaacacaatacaacatagtgtcaatggacctacaaccaacacaatacaacatagtgtcaatggacctacaaccaatacaacatggtgtcaatggacctacaaccaatacaacatggtgtcaatggacctacaaccaatacaacatagtgtcaatggacctacaaccaatacaacatagtgtcaatggacctacaaccaatacaatacaacatagtgtcaatggacctacaaccaacacaatacaacatagtgtcaatggacctacaaccaacacaatacaacatggtgtcaatggacctacaaccaacacaatacaacatggtgtcaatggacctacaaccaatacaatacaacatggtgtcaatggacctacaaccaacacaatacaacatggtgtcaatggacctacaaccaacacaatacaacatggtgtcaatggacctacaaccaatacaacat

Function


NR:

description
Spore coat assembly protein exsA

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU2154622 True 468 TUCP 0.40 2 57012037 57013218

Neighbor


gene id symbol gene type direction distance location
LOC110503004 LOC106611018 coding upstream 168562 56829056 ~ 56843475 (+)
LOC110503003 LOC106611055 coding upstream 183305 56812404 ~ 56828732 (+)
LOC118943924 NA coding upstream 302071 56701366 ~ 56709966 (+)
LOC110503001 LOC106611028 coding upstream 311053 56613066 ~ 56727194 (+)
LOC110503000 prkce coding upstream 401279 56311640 ~ 56610758 (+)
LOC118943926 NA coding downstream 365911 57379129 ~ 57399437 (+)
LOC110503012 LOC106611138 coding downstream 486476 57499694 ~ 57540368 (+)
LOC110503013 NA coding downstream 532057 57545275 ~ 57550796 (+)
LOC110503040 LOC106579579 coding downstream 557528 57570746 ~ 57588495 (+)
LOC118943835 NA coding downstream 1851397 58864615 ~ 58865931 (+)
G1883453 NA non-coding upstream 7360 57004077 ~ 57004677 (+)
G1883423 LOC106610997 non-coding upstream 55346 56947664 ~ 56956691 (+)
G1883414 NA non-coding upstream 76264 56935431 ~ 56935773 (+)
G1883412 NA non-coding upstream 76811 56924307 ~ 56935226 (+)
G1883413 NA non-coding upstream 79696 56931278 ~ 56932341 (+)
G1883460 NA non-coding downstream 2508 57015726 ~ 57016552 (+)
G1883465 NA non-coding downstream 9003 57022221 ~ 57054805 (+)
G1883482 NA non-coding downstream 45152 57058370 ~ 57058976 (+)
G1883486 NA non-coding downstream 51547 57064765 ~ 57065085 (+)
G1883487 NA non-coding downstream 54331 57067549 ~ 57068011 (+)
G1882831 NA other upstream 468781 56533617 ~ 56543256 (+)
G1882830 NA other upstream 473554 56529795 ~ 56538483 (+)
G1881371 NA other upstream 2008365 55002782 ~ 55003672 (+)
G1879958 NA other upstream 3156307 53851671 ~ 53855730 (+)
G1885587 NA other downstream 1848996 58862214 ~ 58864502 (+)
G1886557 NA other downstream 2711046 59724264 ~ 59736661 (+)
G1886558 NA other downstream 2714528 59727746 ~ 59736471 (+)
G1886560 NA other downstream 2736500 59749718 ~ 59786095 (+)
G1886561 NA other downstream 2770768 59783986 ~ 59787989 (+)

Expression


G1883457 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 15.
End of interactive chart.

G1883457 Expression in each Bioproject

Bar chart with 16 bars.
G1883457 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 300.
End of interactive chart.

Co-expression Network