G1885863



Basic Information


Item Value
gene id G1885863
gene name NA
gene type unknown
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048587.1
NCBI id CM023241.2
chromosome length 62880378
location 59089673 ~ 59090564 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU2157260
gcttaacaccccagccatcctacaatctaaacttgatgccctcaatctcacacaaattatcaatgaacctaccaggtacctccccaaagccttaaacacgggcaccctcatagatatcatcctaaccaacttcccctctaaatacacctctgctgtcttcaaccaagatctcagcgatcactgcctcattgcctgcatccgtaatgggtcagcggtcaaacgacctcctctcatcactgtaaaacgctccctgaaacacttcagcgagcaggcctttctaatcgacctggccggggtatcctggaaggatattgacctcatcccgtcagtagaggatgcctggatatttttttaaaaatgccttcctaaccatcttaaataaacatgccccattcaagaaatttagaaccaggaacagatatagcccttggttctccccagacctgactgcccttaatcaacacaaaaacgtcctatggcgttctgcattagcatcgaacagcccccgtgatatgcagctgttcagggaagctagaaaccattatacacaggcagttagaaaagccaaggctagctttttcaagcagaaatttgcttcttgcaacactaactcaaaaagttctgggacactgtaaagtccatggagaataagaacacctcctcccagctgcccactgcactgaagataggaaacactgtcaccactgataaatccaccataattgaaaatttcaataagcatttttctactgctggccatgctttccacctggctactcctacccctgtcaacagcactgcacccccaacagcaactcgcccaagccttccccatttctccttctcccaaatccattcagctgatgttctgaaagagctgcaaaatctggac

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU2157260 True 892 TUCP 0.46 1 59089673 59090564

Neighbor


gene id symbol gene type direction distance location
LOC110503044 nrxn1 coding downstream 322460 58028658 ~ 58767213 (-)
LOC110503041 LOC106579580 coding downstream 1473552 57590001 ~ 57616121 (-)
LOC110503011 LOC106611131 coding downstream 1656217 57389610 ~ 57433456 (-)
LOC110503010 LOC106590975 coding downstream 1708022 57339527 ~ 57381651 (-)
LOC110503007 LOC106586972 coding downstream 1972948 57071327 ~ 57116725 (-)
gpr75 gpr75 coding upstream 256019 59346393 ~ 59351909 (-)
LOC110503043 LOC106611227 coding upstream 265243 59355807 ~ 59454278 (-)
LOC118943927 NA coding upstream 373607 59464171 ~ 59466881 (-)
LOC110503014 LOC106611248 coding upstream 776416 59866980 ~ 59948191 (-)
LOC118943837 LOC106613591 coding upstream 1085235 60175799 ~ 60186033 (-)
G1885648 NA non-coding downstream 171253 58917558 ~ 58918420 (-)
G1885645 NA non-coding downstream 173555 58915566 ~ 58916118 (-)
G1885633 NA non-coding downstream 183839 58905630 ~ 58905834 (-)
G1885630 NA non-coding downstream 186318 58903107 ~ 58903355 (-)
G1885628 NA non-coding downstream 187044 58902347 ~ 58902629 (-)
G1885921 NA non-coding upstream 4845 59095409 ~ 59188677 (-)
G1886064 NA non-coding upstream 107561 59198125 ~ 59199737 (-)
G1886102 NA non-coding upstream 162531 59253095 ~ 59253600 (-)
G1886124 NA non-coding upstream 196508 59287072 ~ 59287337 (-)
G1886145 NA non-coding upstream 218567 59309131 ~ 59309618 (-)
G1885150 NA other downstream 847106 58234219 ~ 58242567 (-)
G1884227 NA other downstream 1354175 57734357 ~ 57735498 (-)
G1883244 NA other downstream 2379785 56644007 ~ 56709888 (-)
G1886825 NA other upstream 875798 59966362 ~ 59966666 (-)
G1886838 NA other upstream 904820 59995384 ~ 59997063 (-)
G1887449 NA other upstream 1683546 60774110 ~ 60825790 (-)
G1887761 NA other upstream 2059492 61150056 ~ 61151170 (-)

Expression


G1885863 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 8.
End of interactive chart.

G1885863 Expression in each Bioproject

Bar chart with 19 bars.
G1885863 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 300.
End of interactive chart.

Co-expression Network