G1887292



Basic Information


Item Value
gene id G1887292
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048587.1
NCBI id CM023241.2
chromosome length 62880378
location 60629018 ~ 60629333 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU2158963
tctcaaatgtgttcgatagggttgaggtcagggctctgtgcaggccagtcaagttcttccacaccgatctcaataaaccatttctgtatggacctcgctttctgcacaggggcattgtcatgttgaaacaggaaagggactttaccaaactgttgccacaaagttagaaacacagaattgtctagaatgtcattgtatgctgtaccgttaagatttcacttcactggaactaaggggcctagcccgaaccatgaaaaacagccccagaccattattcctcctccaccaaacctcacagttggcactatgcattggg

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU2158963 True 316 lncRNA 0.46 1 60629018 60629333
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110514479 LOC106594326 coding downstream 308176 60266566 ~ 60320842 (-)
LOC118936588 LOC106613623 coding downstream 365744 60232501 ~ 60263274 (-)
tarbp1 tarbp1 coding downstream 403850 60186226 ~ 60225168 (-)
LOC118943837 LOC106613591 coding downstream 442986 60175799 ~ 60186033 (-)
LOC110503014 LOC106611248 coding downstream 680827 59866980 ~ 59948191 (-)
adgrb3 adgrb3 coding upstream 310146 60939373 ~ 61274617 (-)
LOC110512348 LOC100135993 coding upstream 766360 61395693 ~ 61399289 (-)
LOC118943930 LOC106577366 coding upstream 1361755 61991088 ~ 62010652 (-)
slc1a4 slc1a4 coding upstream 1390095 62019428 ~ 62062283 (-)
LOC118943932 NA coding upstream 1405644 62034977 ~ 62038662 (-)
LOC110515674 col19a1 non-coding downstream 253432 60371446 ~ 60633294 (-)
G1887200 NA non-coding downstream 257849 60365612 ~ 60371169 (-)
G1887196 NA non-coding downstream 265583 60362611 ~ 60363435 (-)
G1887170 NA non-coding downstream 355694 60273040 ~ 60273324 (-)
G1887305 NA non-coding upstream 11686 60641019 ~ 60641221 (-)
G1887308 NA non-coding upstream 15609 60644942 ~ 60645389 (-)
G1887394 NA non-coding upstream 19191 60648524 ~ 60649794 (-)
G1887395 NA non-coding upstream 24999 60654332 ~ 60655363 (-)
G1887444 NA non-coding upstream 129029 60758362 ~ 60775659 (-)
G1886838 NA other downstream 631955 59995384 ~ 59997063 (-)
G1886825 NA other downstream 662352 59966362 ~ 59966666 (-)
gpr75 gpr75 other downstream 1277148 59346393 ~ 59351909 (-)
G1885863 NA other downstream 1538454 59089673 ~ 59090564 (-)
G1885150 NA other downstream 2386451 58234219 ~ 58242567 (-)
G1887449 NA other upstream 144777 60774110 ~ 60825790 (-)
G1887761 NA other upstream 520723 61150056 ~ 61151170 (-)
LOC118943840 NA other upstream 1525895 62152136 ~ 62164324 (-)
G1888836 LOC106562881 other upstream 1631504 62260837 ~ 62267505 (-)
LOC110532867 LOC106562881 other upstream 1640289 62258118 ~ 62273944 (-)

Expression


G1887292 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 25.
End of interactive chart.

G1887292 Expression in each Bioproject

Bar chart with 19 bars.
G1887292 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 100.
End of interactive chart.

Co-expression Network