XLOC_037995 (BX294189.1)


Basic Information

Item Value
gene id XLOC_037995
gene name BX294189.1
gene type non-coding
species zebrafish (Danio rerio)
category of species model fish

Chromosome Information

Item Value
chromosome id NC_007120.7
NCBI id CM002893.2
chromosome length 56459846
location 34326430 ~ 34328502 (-)
genome version GRCz11_2017_zebrafish_Genome

Sequence

>TCONS_00074554
ggcgtgactcctttttcattgcccgggatttagcaggcagacgcagcttctgcaatggtcgacattaactgctcccagcagcggatctgattaacacgataccaaagtgattttgttacctgtggatcttcaaacttcacatccagagttgtgaggaatcagaggtgcatgcagctgcccacgggaaaaatttgccatcagcccaacacagtttggattatcataggactgtcagaggtttgccaaacctgtcaaatgcatgatggctcctgtttggacttaccgatgtcctcgacttcaagtatccatcaaaactgtatacatttgagatatatcagagactctttgtggggctggacattatgcatcctaaatcttcatcaaaatatgcaaatctcctcactgagttgccttagatgatttctcaataggatctggtattattaatgtttttatttatgtattgtgtacgtgtagccacattaatggcctattttgtagtcactattaaaaggaacattgattgatattgaatacatgttatggtctttaatccatcttcccattcttatttaattgttattgacaggaaagtctgtttatctgtttttcctagtgtatattgtgcttacaatatcgaaacgaagatttattttctaaggttacagccagaagttaattgaattaattttaaatcaaatatgcatggttaattttatttagataattaagttcataatacttaattaaaataagtacagtcaacatatagcaatgtataagtaagttaagttt
>TCONS_00074555
tgtgggggttcagtttgttagcgctaacttagctaaagttagctcacctaagttatagcagcacattaaggatggatattaaatgcagaaacatatgcaacagttaagtagtttgtgtttaacgtaagagaaagtacaacttaaagtttgtgttttagagatttattCCATAagtttttttaatgctgcatagtgaataaattacagatttacaatttattttaacttaaattacatttactgatgtttacagaaccatttaaactgtatgcacctcattctaaaatgcatgttcttggtctttagataccaaagtgattttgttacctgtggatcttcaaacttcacatccagagttgtgaggaatcagaggtgcatgcagctgcccacgggaaaaatttgccatcagcccaacacagtttggattatcataggactgtcagaggtttgccaaacctgtcaaatgcatgatggctcctgtttggacttaccgatgtcctcgacttcaagtatccatcaaaactgtatacatttgagatatatcagagactctttgtggggctggacattatgcatcctaaatcttcatcaaaatatgcaaatctcctcactgagttgccttagatgatttctcaataggatctggtattattaatgtttttatttatgtattgtgtacgtgtagccacattaatggcctattttgtagtcactattaaaaggaacattgattgatattgaatacatgttatggtctttaatccatc
>TCONS_00074556
cttctgcaatggtcgacattaactgctcccagcagcggatctgattaacacgagttgtgaggaatcagaggtgcatgcagctgcccacgggaaaaatttgccatcagcccaacacagtttggattatcataggactgtcagaggtttgccaaacctgtcaaatgcatgatggctcctgtttggacttaccgatgtcctcgacttcaagtatccatcaaaactgtatacatttgagatatatcagagactctttgtggggctggacattatgcatcctaaatcttcatcaaaatatgcaaatctcctcactgagttgccttagatgatttctcaataggatctggtattattaatgtttttatttatgtattgtgtacgtgtagccacattaatggcctattttgtagtcactattaaaaggaacattgattgatattgaat

Function

GO:

id name namespace
GO:0001704 formation of primary germ layer biological_process
GO:0001706 endoderm formation biological_process
GO:0019219 regulation of nucleobase-containing compound metabolic process biological_process
GO:0016070 RNA metabolic process biological_process
GO:0007492 endoderm development biological_process
GO:0018130 heterocycle biosynthetic process biological_process
GO:0006351 transcription, DNA-templated biological_process
GO:0051171 regulation of nitrogen compound metabolic process biological_process
GO:0097659 nucleic acid-templated transcription biological_process
GO:1903224 regulation of endodermal cell differentiation biological_process
GO:0051252 regulation of RNA metabolic process biological_process
GO:1901362 organic cyclic compound biosynthetic process biological_process
GO:0010467 gene expression biological_process
GO:0010468 regulation of gene expression biological_process
GO:0044271 cellular nitrogen compound biosynthetic process biological_process
GO:0060255 regulation of macromolecule metabolic process biological_process
GO:0032774 RNA biosynthetic process biological_process
GO:0019438 aromatic compound biosynthetic process biological_process
GO:0034654 nucleobase-containing compound biosynthetic process biological_process
GO:0035987 endodermal cell differentiation biological_process
GO:0005634 nucleus cellular_component
GO:0043565 sequence-specific DNA binding molecular_function
GO:0003676 nucleic acid binding molecular_function
GO:0003690 double-stranded DNA binding molecular_function
GO:0003700 DNA-binding transcription factor activity molecular_function
GO:0000976 transcription regulatory region sequence-specific DNA binding molecular_function
GO:0000977 RNA polymerase II transcription regulatory region sequence-specific DNA binding molecular_function
GO:0000978 RNA polymerase II cis-regulatory region sequence-specific DNA binding molecular_function
GO:0000987 cis-regulatory region sequence-specific DNA binding molecular_function
GO:0140110 transcription regulator activity molecular_function
GO:0001067 regulatory region nucleic acid binding molecular_function
GO:1990837 sequence-specific double-stranded DNA binding molecular_function

KEGG: NA

Ensembl:

ensembl_id ENSDARG00000093137

RNA

RNA id representative length rna type GC content exon number start site end site
TCONS_00074554 False 795 lncRNA 0.36 3 34326430 34328502
TCONS_00074555 False 767 lncRNA 0.35 2 34326666 34328115
TCONS_00074556 True 441 lncRNA 0.40 2 34326690 34328456

Neighbor

gene id symbol gene type direction distance location
XLOC_037994 gpa33b coding downstream 18317 34307140 ~ 34308113 (-)
XLOC_037993 ildr2 coding downstream 25723 34274501 ~ 34300707 (-)
XLOC_037992 ildr1b coding downstream 57364 34260604 ~ 34269066 (-)
XLOC_037991 me3 coding downstream 66216 34246384 ~ 34260214 (-)
XLOC_037990 dcaf6 coding downstream 107065 34166064 ~ 34219365 (-)
XLOC_037996 NA coding upstream 22015 34350517 ~ 34355550 (-)
XLOC_037997 cd247l coding upstream 28393 34356895 ~ 34368842 (-)
XLOC_037998 grtp1b coding upstream 61474 34389976 ~ 34396264 (-)
XLOC_037999 ppp2r3b coding upstream 155952 34484454 ~ 34509997 (-)
XLOC_038000 NA coding upstream 218164 34546666 ~ 34587807 (-)
XLOC_037988 NA non-coding downstream 243204 34069736 ~ 34083226 (-)
XLOC_037987 NA non-coding downstream 260824 34064509 ~ 34065606 (-)
XLOC_037985 dre-mir-222a non-coding downstream 370491 33921464 ~ 33955939 (-)
XLOC_037986 NA non-coding downstream 383294 33942193 ~ 33943136 (-)
XLOC_037984 dre-mir-221 non-coding downstream 405406 33920932 ~ 33921024 (-)
XLOC_038001 NA non-coding upstream 263524 34592026 ~ 34812883 (-)
XLOC_038002 BX601644.5 non-coding upstream 424542 34753044 ~ 34753159 (-)
XLOC_038004 BX601644.3 non-coding upstream 520358 34848860 ~ 34851804 (-)

Expression


Co-expression Network