G1893762



Basic Information


Item Value
gene id G1893762
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048588.1
NCBI id CM023242.2
chromosome length 45930806
location 3823966 ~ 3824179 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU2166345
GTCAGAACTAGTGGACTTCGTTATTTACAGCATGTATAGTATAAGCCTTGAACAGCTTTTACAGGTGTATTGTGATGGCCAGGACCTGCTAATAAACAGGACGATGGCAAAAGGTGGAGAGGTGCTCTTGCTCCTAGAGAAGCTGAAGACCTCTGGTGCTCCTCTCCCCTGAAACGTGTGACGAGGCCCTGTAGAATTTTTTTTTGATCACCGT

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU2166345 True 214 lncRNA 0.46 1 3823966 3824179

Neighbor


gene id symbol gene type direction distance location
LOC110503499 ap2s1 coding downstream 12938 3805042 ~ 3811028 (-)
LOC110503502 LOC106612376 coding downstream 136548 3676671 ~ 3687418 (-)
LOC110503301 ptgir coding downstream 181481 3599139 ~ 3642485 (-)
LOC110503506 gemin7 coding downstream 391140 3430127 ~ 3432826 (-)
LOC110503302 LOC106612383 coding downstream 411822 3399735 ~ 3412144 (-)
LOC118944023 tmem160 coding upstream 208735 4032914 ~ 4037053 (-)
egln2 egln2 coding upstream 229599 4053778 ~ 4075685 (-)
LOC110503493 LOC107566082 coding upstream 349841 4174020 ~ 4176885 (-)
si:dkey-202l22.3 LOC106612399 coding upstream 465707 4289886 ~ 4294714 (-)
LOC118944008 NA coding upstream 479832 4304011 ~ 4304884 (-)
G1893761 NA non-coding downstream 549 3823006 ~ 3823417 (-)
G1893758 NA non-coding downstream 4254 3818872 ~ 3819712 (-)
G1893748 LOC106612374 non-coding downstream 24709 3790382 ~ 3799257 (-)
G1893719 NA non-coding downstream 80108 3743655 ~ 3743858 (-)
G1893718 NA non-coding downstream 83165 3740499 ~ 3740801 (-)
G1893763 NA non-coding upstream 119 3824298 ~ 3824676 (-)
G1893764 NA non-coding upstream 643 3824822 ~ 3825036 (-)
G1893765 NA non-coding upstream 1349 3825528 ~ 3826077 (-)
G1893766 NA non-coding upstream 2731 3826910 ~ 3827141 (-)
G1893767 NA non-coding upstream 2997 3827176 ~ 3827465 (-)
G1892888 NA other downstream 804525 3013455 ~ 3019441 (-)
G1892841 NA other downstream 886915 2936184 ~ 2937051 (-)
G1891499 NA other downstream 2018904 1802008 ~ 1805430 (-)
LOC110503527 med29 other downstream 2732976 1087227 ~ 1091024 (-)
G1889857 NA other downstream 3264867 557130 ~ 559099 (-)
G1893790 LOC106612372 other upstream 86530 3881288 ~ 3914848 (-)
G1894611 NA other upstream 529399 4353578 ~ 4353936 (-)
G1896030 NA other upstream 2044717 5868896 ~ 5869218 (-)

Expression


G1893762 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 3.
End of interactive chart.

G1893762 Expression in each Bioproject

Bar chart with 10 bars.
G1893762 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 10.
End of interactive chart.

Co-expression Network