G1895801



Basic Information


Item Value
gene id G1895801
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048588.1
NCBI id CM023242.2
chromosome length 45930806
location 5820057 ~ 5820286 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU2168579
GTCCAATATTCTGTAGCATTACATTTGAGGGCTTCTCTCAAGAGGGCCTCCACAAAGTATTCTACCTGTGATTTTAAAAAGCAATCTATTGGGCACAAAGACATGTGCAAGCCACTGCAGTGCATGCCACAGTATGGCTGTACGAAGTTCTTCTTGTCACTCTGCCAACATCTCTTTACTGCAAGATGAAGAGGATGATTCAAGCTACTATCCTTCCCTCTCGGCACTCT

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU2168579 True 230 lncRNA 0.44 1 5820057 5820286
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110503579 LOC106612719 coding downstream 294297 5520441 ~ 5525760 (-)
LOC110503580 LOC106612720 coding downstream 301285 5514730 ~ 5518772 (-)
LOC110503446 LOC106605018 coding downstream 308020 5511049 ~ 5512037 (-)
LOC110503578 NA coding downstream 309665 5503177 ~ 5510392 (-)
LOC110503577 LOC106612723 coding downstream 325627 5490835 ~ 5494430 (-)
LOC110503586 LOC100380764 coding upstream 327903 6148189 ~ 6157661 (-)
LOC110503585 LOC106612713 coding upstream 339425 6159711 ~ 6175088 (-)
LOC118944082 NA coding upstream 362124 6181377 ~ 6231808 (-)
LOC118944097 NA coding upstream 448632 6264040 ~ 6317522 (-)
LOC110503590 LOC106612705 coding upstream 551784 6371958 ~ 6472758 (-)
G1895777 NA non-coding downstream 36761 5783078 ~ 5783296 (-)
G1895735 NA non-coding downstream 44471 5775354 ~ 5775586 (-)
G1895732 NA non-coding downstream 46411 5773347 ~ 5773646 (-)
G1895636 NA non-coding downstream 104683 5715065 ~ 5715374 (-)
G1895611 NA non-coding downstream 121079 5698478 ~ 5698978 (-)
G1895833 NA non-coding upstream 24775 5845061 ~ 5845339 (-)
G1896021 NA non-coding upstream 31304 5851590 ~ 5851825 (-)
G1896028 NA non-coding upstream 40079 5860365 ~ 5860598 (-)
G1896031 NA non-coding upstream 49167 5869453 ~ 5869704 (-)
G1896038 NA non-coding upstream 54327 5874613 ~ 5966164 (-)
G1894611 NA other downstream 1466121 4353578 ~ 4353936 (-)
si:dkey-202l22.3 LOC106612399 other downstream 1525579 4289886 ~ 4294714 (-)
egln2 egln2 other downstream 1744482 4053778 ~ 4075685 (-)
G1893790 LOC106612372 other downstream 1905209 3881288 ~ 3914848 (-)
G1892888 NA other downstream 2800616 3013455 ~ 3019441 (-)
G1896030 NA other upstream 48610 5868896 ~ 5869218 (-)
G1899875 NA other upstream 2226493 8046779 ~ 8047974 (-)
LOC110503680 LOC106612628 other upstream 3750585 9570867 ~ 9579939 (-)

Expression


G1895801 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 2.
End of interactive chart.

G1895801 Expression in each Bioproject

Bar chart with 1 bar.
G1895801 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 20.
End of interactive chart.

Co-expression Network