G1896030



Basic Information


Item Value
gene id G1896030
gene name NA
gene type unknown
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048588.1
NCBI id CM023242.2
chromosome length 45930806
location 5868896 ~ 5869218 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU2168814
gtaagagcattgaagatgggtcgtcgctgggtcttccagcatgacaacgacccgaaacacacagccagggcaactaaggagtggctccgtaagaagtatctcaaggtcctggagtggcctagccagtctccagacctgaacacaatagaaaatctttggagggacctgaaagtctgtattgcccagcgacagccccgaaacctgaaggatctggagaaggtctgtatggaggagtgggccaaaatccctgctgcagtgtgtgcaaacctggtcaagaactacaggaaacgtatgatctctgtaattgcaaacaaaggtttctg

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU2168814 True 323 TUCP 0.50 1 5868896 5869218
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110503579 LOC106612719 coding downstream 343136 5520441 ~ 5525760 (-)
LOC110503580 LOC106612720 coding downstream 350124 5514730 ~ 5518772 (-)
LOC110503446 LOC106605018 coding downstream 356859 5511049 ~ 5512037 (-)
LOC110503578 NA coding downstream 358504 5503177 ~ 5510392 (-)
LOC110503577 LOC106612723 coding downstream 374466 5490835 ~ 5494430 (-)
LOC110503586 LOC100380764 coding upstream 278971 6148189 ~ 6157661 (-)
LOC110503585 LOC106612713 coding upstream 290493 6159711 ~ 6175088 (-)
LOC118944082 NA coding upstream 313192 6181377 ~ 6231808 (-)
LOC118944097 NA coding upstream 399700 6264040 ~ 6317522 (-)
LOC110503590 LOC106612705 coding upstream 502852 6371958 ~ 6472758 (-)
G1896028 NA non-coding downstream 8298 5860365 ~ 5860598 (-)
G1896021 NA non-coding downstream 17071 5851590 ~ 5851825 (-)
G1895833 NA non-coding downstream 23557 5845061 ~ 5845339 (-)
G1895801 NA non-coding downstream 48610 5820057 ~ 5820286 (-)
G1895777 NA non-coding downstream 85600 5783078 ~ 5783296 (-)
G1896031 NA non-coding upstream 235 5869453 ~ 5869704 (-)
G1896038 NA non-coding upstream 5395 5874613 ~ 5966164 (-)
G1896162 NA non-coding upstream 176375 6045593 ~ 6048631 (-)
G1896182 LOC106612716 non-coding upstream 204927 6074145 ~ 6076485 (-)
G1896213 NA non-coding upstream 239702 6108920 ~ 6109127 (-)
G1894611 NA other downstream 1514960 4353578 ~ 4353936 (-)
si:dkey-202l22.3 LOC106612399 other downstream 1574418 4289886 ~ 4294714 (-)
egln2 egln2 other downstream 1793321 4053778 ~ 4075685 (-)
G1893790 LOC106612372 other downstream 1954048 3881288 ~ 3914848 (-)
G1892888 NA other downstream 2849455 3013455 ~ 3019441 (-)
G1899875 NA other upstream 2177561 8046779 ~ 8047974 (-)
LOC110503680 LOC106612628 other upstream 3701653 9570867 ~ 9579939 (-)
G1901072 LOC107388308 other upstream 4136154 10005372 ~ 10012354 (-)

Expression


G1896030 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 2.
End of interactive chart.

G1896030 Expression in each Bioproject

Bar chart with 19 bars.
G1896030 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 40.
End of interactive chart.

Co-expression Network