G1901129



Basic Information


Item Value
gene id G1901129
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048588.1
NCBI id CM023242.2
chromosome length 45930806
location 10079342 ~ 10079572 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU2174394
GGATATGAAAGAATACCGAACCTGTGAGTAGCAGCGTTTGAGTAGCCCCCTGTTCTTCAGCAACTTGATGAAGTAGTGACATACTGTGGGCTTAACACACAACAACACTGCTGTTAGTGAGACCTAATAATACACAGGCACCAACTGCACAATTCAGGAAATTAAGTTAAGAAAAAGCCAGAAAATAGGCTTGATCCTACCTTAAACTGTCCTGGGTACAGCTCCCTGGCC

Function


NR:

description
NAD-dependent protein deacetylase sirtuin-2

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU2174394 True 231 lncRNA 0.44 1 10079342 10079572

Neighbor


gene id symbol gene type direction distance location
LOC110503698 LOC107388308 coding downstream 66938 10009361 ~ 10012404 (-)
LOC110503700 LOC107388308 coding downstream 70355 10005340 ~ 10008987 (-)
LOC110503696 LOC106612616 coding downstream 95300 9979013 ~ 9984042 (-)
LOC110503694 NA coding downstream 137574 9924311 ~ 9941768 (-)
LOC110503691 LOC106612619 coding downstream 181404 9892221 ~ 9897938 (-)
LOC110503704 LOC106612609 coding upstream 24994 10104566 ~ 10114248 (-)
LOC110503316 prss16 coding upstream 50320 10129892 ~ 10139994 (-)
LOC110503705 hnrnpl coding upstream 63456 10143028 ~ 10153094 (-)
LOC110503706 LOC105026808 coding upstream 72718 10152290 ~ 10159142 (-)
LOC110503317 LOC106612604 coding upstream 81322 10160894 ~ 10263430 (-)
G1901128 NA non-coding downstream 69 10078891 ~ 10079273 (-)
G1901126 NA non-coding downstream 6870 10072238 ~ 10072472 (-)
G1901100 NA non-coding downstream 52273 10026853 ~ 10027069 (-)
G1901088 NA non-coding downstream 92732 9986142 ~ 9986610 (-)
G1901087 NA non-coding downstream 93448 9984308 ~ 9985894 (-)
G1901131 NA non-coding upstream 1101 10080673 ~ 10080949 (-)
G1901134 NA non-coding upstream 3828 10083400 ~ 10083697 (-)
G1901136 NA non-coding upstream 4929 10084501 ~ 10084806 (-)
G1901137 NA non-coding upstream 5298 10084870 ~ 10085101 (-)
G1901138 NA non-coding upstream 6420 10085992 ~ 10086250 (-)
G1901072 LOC107388308 other downstream 66988 10005372 ~ 10012354 (-)
LOC110503680 LOC106612628 other downstream 505193 9570867 ~ 9579939 (-)
G1899875 NA other downstream 2031368 8046779 ~ 8047974 (-)
LOC110503590 LOC106612705 other downstream 3619277 6371958 ~ 6472758 (-)
LOC118944082 NA other downstream 3847534 6181377 ~ 6231808 (-)
G1901206 NA other upstream 125648 10205220 ~ 10205948 (-)
G1901302 LOC106612600 other upstream 319470 10399042 ~ 10399857 (-)
G1901405 NA other upstream 537352 10616924 ~ 10617481 (-)
G1901516 NA other upstream 774259 10853831 ~ 10856437 (-)
LOC110503734 rnf7 other upstream 835982 10915471 ~ 10918092 (-)

Expression


G1901129 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 2.
End of interactive chart.

G1901129 Expression in each Bioproject

Bar chart with 6 bars.
G1901129 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 12.
End of interactive chart.

Co-expression Network