G1898924



Basic Information


Item Value
gene id G1898924
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048588.1
NCBI id CM023242.2
chromosome length 45930806
location 10564227 ~ 10564436 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU2172001
aaattcattaaaaatcctacaatgtgattttctgtcatagttgaagtgtacctatgatgaaaattacaggcctctctcatctttttaagtgggagaacttgcacaattggtggctgtctaaatacttttttgccccactgtatatatacactgctcaaaaaaataaagggaacactaaaataacacatcctagatctgaatgaatgaaat

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU2172001 True 210 lncRNA 0.33 1 10564227 10564436
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110503716 LOC106580865 coding upstream 3908 10543581 ~ 10560319 (+)
LOC110503712 LOC106612598 coding upstream 136457 10410751 ~ 10427770 (+)
LOC110503711 LOC106580858 coding upstream 162105 10395966 ~ 10402123 (+)
LOC110503709 LOC106612599 coding upstream 168379 10373133 ~ 10395848 (+)
LOC118944011 NA coding upstream 335519 10205598 ~ 10228708 (+)
LOC110503719 LOC106612592 coding downstream 6935 10571371 ~ 10579935 (+)
LOC110503720 ercc2 coding downstream 17954 10582390 ~ 10594857 (+)
LOC110503723 LOC106612591 coding downstream 68635 10633071 ~ 10636790 (+)
LOC110503725 LOC106612733 coding downstream 141771 10706207 ~ 10709800 (+)
LOC118944016 LOC106931471 coding downstream 166296 10730732 ~ 10758090 (+)
G1898923 NA non-coding upstream 567 10563403 ~ 10563660 (+)
G1898881 LOC106612595 non-coding upstream 79623 10483855 ~ 10484604 (+)
G1898880 NA non-coding upstream 84575 10477958 ~ 10479652 (+)
G1898871 NA non-coding upstream 98621 10465401 ~ 10465606 (+)
G1898869 NA non-coding upstream 99617 10464373 ~ 10464610 (+)
G1898925 NA non-coding downstream 375 10564811 ~ 10565071 (+)
G1898927 NA non-coding downstream 2022 10566458 ~ 10566763 (+)
G1898954 NA non-coding downstream 52452 10616888 ~ 10617461 (+)
G1899035 NA non-coding downstream 201514 10765950 ~ 10768070 (+)
G1898883 NA other upstream 75893 10487853 ~ 10488334 (+)
G1898772 NA other upstream 259809 10303182 ~ 10304418 (+)
G1898545 LOC106612623 other upstream 714888 9848472 ~ 9849339 (+)
G1898441 NA other upstream 974536 9588040 ~ 9589691 (+)
G1898930 NA other downstream 19679 10584115 ~ 10584449 (+)
G1901545 NA other downstream 307222 10871658 ~ 10872906 (+)
LOC118944017 NA other downstream 478095 11040237 ~ 11044659 (+)
LOC110503322 LOC106612564 other downstream 1012515 11494038 ~ 11583941 (+)

Expression


G1898924 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 30.
End of interactive chart.

G1898924 Expression in each Bioproject

Bar chart with 17 bars.
G1898924 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 1000.
End of interactive chart.

Co-expression Network