G1901546



Basic Information


Item Value
gene id G1901546
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048588.1
NCBI id CM023242.2
chromosome length 45930806
location 10873078 ~ 10873347 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU2174877
GTATTAGGCTACAACATTGTGGTGAGAAGAGATGGTGTATTAGGCTACAACATTGTGGTGAGAAGAGATGGTGTATTAGGCTACAACATTGTGGTGAGAAGAGATGGTGTATTAGGCTACAACATTGTTGTGAGAAGAGATGGGTGTACTAGGCTACAACATTGTGGTGAGAAGAGATGGTGTATTAGGCTACAACATTGTGGTGAGAAGAGATGGTGTATTAGGCTACAACATTGTGGTGAGAAGAGATGGTGTATTAGGCTACAACAT

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU2174877 True 270 lncRNA 0.41 1 10873078 10873347

Neighbor


gene id symbol gene type direction distance location
LOC110503318 LOC106612575 coding upstream 16587 10827276 ~ 10856491 (+)
LOC110503730 bcl7b coding upstream 56803 10813213 ~ 10816275 (+)
LOC118944016 LOC106931471 coding upstream 114988 10730732 ~ 10758090 (+)
LOC110503725 LOC106612733 coding upstream 163278 10706207 ~ 10709800 (+)
LOC110503723 LOC106612591 coding upstream 236288 10633071 ~ 10636790 (+)
LOC110503736 fa70b coding downstream 58532 10931879 ~ 10971014 (+)
LOC110503739 NA coding downstream 153584 11026931 ~ 11029263 (+)
LOC118944017 NA coding downstream 166890 11040237 ~ 11044659 (+)
trip12 NA coding downstream 175289 11048636 ~ 11106085 (+)
LOC110503319 LOC100380637 coding downstream 239070 11112417 ~ 11192759 (+)
G1901499 NA non-coding upstream 49994 10822314 ~ 10823084 (+)
G1901498 NA non-coding upstream 50850 10821527 ~ 10822228 (+)
G1901497 NA non-coding upstream 51571 10821179 ~ 10821507 (+)
G1899063 NA non-coding upstream 55502 10817116 ~ 10817576 (+)
G1899036 NA non-coding upstream 60052 10812909 ~ 10813026 (+)
G1901550 LOC106601083 non-coding downstream 6931 10880278 ~ 10880683 (+)
G1901604 NA non-coding downstream 108981 10982328 ~ 10982668 (+)
G1901605 NA non-coding downstream 110586 10983933 ~ 10988450 (+)
G1901606 NA non-coding downstream 116599 10989946 ~ 10990391 (+)
G1901635 NA non-coding downstream 165839 11039186 ~ 11039506 (+)
G1901545 NA other upstream 172 10871658 ~ 10872906 (+)
G1898930 NA other upstream 288629 10584115 ~ 10584449 (+)
LOC110503716 LOC106580865 other upstream 323266 10543581 ~ 10560319 (+)
G1898883 NA other upstream 384744 10487853 ~ 10488334 (+)
LOC110503322 LOC106612564 other downstream 703604 11494038 ~ 11583941 (+)
G1902710 NA other downstream 1439228 12312575 ~ 12313457 (+)
G1903192 NA other downstream 1665374 12538721 ~ 12544378 (+)
G1903195 LOC106591448 other downstream 1669013 12542360 ~ 12547857 (+)

Expression


G1901546 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 5.
End of interactive chart.

G1901546 Expression in each Bioproject

Bar chart with 9 bars.
G1901546 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 70.
End of interactive chart.

Co-expression Network