G1907951



Basic Information


Item Value
gene id G1907951
gene name NA
gene type unknown
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048588.1
NCBI id CM023242.2
chromosome length 45930806
location 16158846 ~ 16161226 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU2182093
CATCCGTTATTGGAACTGTGGTAGTTAGTCGCCCGTCACACTCCTCAATTCTCCGCAATACGGAGTTGCTGGAAGGAACCACCTGACTATGCATGGAACCACCCTAACACCCGACTATGCATGGAACCACCCTACCACCCGACTATGTATGGAACCCCCCTACCACCCGACTATGCATGGGACCACCCTACCACCCGACTATGCATGGAACCACCCTACCACCCGACTATGTATGGAACCACCCTACCACCCGACTATGCATGGGACCACCCTACCACCCGAGTATGCATGGAACCACCCTACCACCCGACTATGTATGGAACCACCCTACCACCCGAGTATGCATGGTACCACCC

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU2182093 True 356 TUCP 0.55 2 16158846 16161226

Neighbor


gene id symbol gene type direction distance location
slc46a1 slc46a1 coding downstream 20333 16133164 ~ 16138513 (-)
LOC110503846 NA coding downstream 114106 16036987 ~ 16044740 (-)
LOC110503843 bcas3 coding downstream 130172 15678320 ~ 16028674 (-)
LOC110503841 LOC106612865 coding downstream 494565 15654551 ~ 15664281 (-)
LOC110503840 LOC106612866 coding downstream 527359 15599083 ~ 15631487 (-)
LOC110503852 LOC106612852 coding upstream 36820 16198046 ~ 16224497 (-)
LOC110503854 LOC106612853 coding upstream 66345 16227571 ~ 16234629 (-)
LOC110503859 LOC106612846 coding upstream 232050 16393276 ~ 16407374 (-)
aipl1 LOC106612843 coding upstream 252459 16413685 ~ 16422281 (-)
abhd15a LOC106612842 coding upstream 344786 16506012 ~ 16515306 (-)
G1907914 NA non-coding downstream 27599 16130812 ~ 16131247 (-)
G1907940 NA non-coding downstream 43419 16115049 ~ 16115427 (-)
G1907939 NA non-coding downstream 46085 16112406 ~ 16112761 (-)
G1907934 NA non-coding downstream 53979 16104503 ~ 16104867 (-)
G1907856 NA non-coding downstream 121987 15969611 ~ 16036859 (-)
G1907962 NA non-coding upstream 23809 16185035 ~ 16185488 (-)
G1908004 LOC106612850 non-coding upstream 101348 16262574 ~ 16264753 (-)
G1908067 NA non-coding upstream 166483 16327709 ~ 16328139 (-)
G1908029 NA non-coding upstream 300194 16461420 ~ 16476960 (-)
G1908202 LOC106612839 non-coding upstream 456746 16617972 ~ 16622138 (-)
G1907922 NA other downstream 26284 16131990 ~ 16132562 (-)
G1906218 NA other downstream 645753 15512359 ~ 15513093 (-)
G1906198 NA other downstream 658086 15500204 ~ 15500760 (-)
G1906115 NA other downstream 804273 15353940 ~ 15354573 (-)
LOC118944080 LOC106612823 other upstream 1116581 17277554 ~ 17278524 (-)
LOC110503924 LOC107554284 other upstream 2270798 18432024 ~ 18434798 (-)
LOC110503944 LOC106612932 other upstream 2806836 18968062 ~ 19185772 (-)
G1910398 NA other upstream 2999223 19160449 ~ 19162158 (-)
G1910539 NA other upstream 3171615 19332841 ~ 19333225 (-)

Expression


G1907951 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 40.
End of interactive chart.

G1907951 Expression in each Bioproject

Bar chart with 6 bars.
G1907951 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 800.
End of interactive chart.

Co-expression Network