G1908606



Basic Information


Item Value
gene id G1908606
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048588.1
NCBI id CM023242.2
chromosome length 45930806
location 17310332 ~ 17314262 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU2182824
agcaaactctctccagaagttcagtgaggatctctgaatgatccaatgttgacctaaatgactaatgatgataaatacaatccacctgtgtgtaatcaagtctccgtataaatgcacctgcactgtgatagtctcagaggtccgttaaaagcgcagagagcatcatgaagaacaaggaacacaccaggcaggtccgagatactgttgtgaagaagtttaaagccggatttggataaaaaaagatttcccaagctttaaacatcccaaggagcactgtgcaagcgataatattgaaatggaaggagtatcagaccactgcaaatctaccaagacctggccgtccctctaaactttcagctcatacaaggag

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU2182824 True 370 lncRNA 0.43 2 17310332 17314262
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110503457 LOC106612822 coding downstream 28807 17279898 ~ 17281525 (-)
LOC118944080 LOC106612823 coding downstream 31808 17277554 ~ 17278524 (-)
LOC110503887 LOC106612825 coding downstream 33851 17274422 ~ 17276481 (-)
LOC110503885 chchd2 coding downstream 65862 17240222 ~ 17244470 (-)
LOC110503884 psph coding downstream 92829 17210966 ~ 17217503 (-)
LOC110503890 LOC106581067 coding upstream 11332 17325594 ~ 17329423 (-)
LOC110503892 LOC106612816 coding upstream 218859 17533121 ~ 17549493 (-)
LOC110503896 LOC106612812 coding upstream 326116 17640378 ~ 17658271 (-)
itgae.2 itgae coding upstream 344196 17658458 ~ 17671274 (-)
LOC110503899 LOC106612809 coding upstream 386043 17700305 ~ 17716362 (-)
G1908604 LOC106612819 non-coding downstream 1229 17306581 ~ 17309103 (-)
G1908551 LOC106612827 non-coding downstream 76628 17230892 ~ 17233704 (-)
LOC110503876 LOC106612831 non-coding downstream 312847 16993507 ~ 17087259 (-)
G1908373 NA non-coding downstream 473221 16836742 ~ 16837111 (-)
G1908301 NA non-coding downstream 513692 16751127 ~ 16796640 (-)
G1908714 NA non-coding upstream 210194 17524456 ~ 17531758 (-)
G1908777 NA non-coding upstream 258584 17572846 ~ 17573066 (-)
G1908789 NA non-coding upstream 267543 17581805 ~ 17582118 (-)
G1908791 NA non-coding upstream 269492 17583754 ~ 17584118 (-)
G1908792 NA non-coding upstream 270262 17584524 ~ 17584789 (-)
G1907951 NA other downstream 1149106 16158846 ~ 16161226 (-)
G1907922 NA other downstream 1177770 16131990 ~ 16132562 (-)
LOC110503846 NA other downstream 1266027 16036987 ~ 16044740 (-)
G1906218 NA other downstream 1797239 15512359 ~ 15513093 (-)
LOC110503924 LOC107554284 other upstream 1117762 18432024 ~ 18434798 (-)
LOC110503944 LOC106612932 other upstream 1653800 18968062 ~ 19185772 (-)
G1910398 NA other upstream 1846187 19160449 ~ 19162158 (-)
G1910539 NA other upstream 2018579 19332841 ~ 19333225 (-)
G1910651 NA other upstream 2176455 19490717 ~ 19491608 (-)

Expression


G1908606 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 3.
End of interactive chart.

G1908606 Expression in each Bioproject

Bar chart with 19 bars.
G1908606 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 100.
End of interactive chart.

Co-expression Network