G1908789



Basic Information


Item Value
gene id G1908789
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048588.1
NCBI id CM023242.2
chromosome length 45930806
location 17581805 ~ 17582118 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU2183032
aaattattcagcccctttactttcagtgcagcaagctctctccagaagttcagtgaggatctctgaatgatccaatgttgacctaaatgactaatgatgataaatacaatccacctgtgtgtaatcaagtctccgtataaatgcacctgcactgtgatagtctcagaggtccgttaaaagtgcagagagcatcatgaagaacaaggaacacaccaggcaggtccgagatactgttgtgaagaagttttaaagccggatttggatacaaaaagatttcccaagctttaaacatcccaaggagcactgtgaaagcg

Function


NR:

description
unnamed protein product, partial

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU2183032 True 314 lncRNA 0.42 1 17581805 17582118

Neighbor


gene id symbol gene type direction distance location
LOC110503892 LOC106612816 coding downstream 32312 17533121 ~ 17549493 (-)
LOC110503890 LOC106581067 coding downstream 252382 17325594 ~ 17329423 (-)
LOC110503457 LOC106612822 coding downstream 300280 17279898 ~ 17281525 (-)
LOC118944080 LOC106612823 coding downstream 303281 17277554 ~ 17278524 (-)
LOC110503887 LOC106612825 coding downstream 305324 17274422 ~ 17276481 (-)
LOC110503896 LOC106612812 coding upstream 58260 17640378 ~ 17658271 (-)
itgae.2 itgae coding upstream 76340 17658458 ~ 17671274 (-)
LOC110503899 LOC106612809 coding upstream 118187 17700305 ~ 17716362 (-)
LOC110503901 LOC106612808 coding upstream 157070 17739188 ~ 17814508 (-)
LOC110503902 LOC106612804 coding upstream 244074 17826192 ~ 17831204 (-)
G1908777 NA non-coding downstream 8739 17572846 ~ 17573066 (-)
G1908714 NA non-coding downstream 50047 17524456 ~ 17531758 (-)
G1908606 NA non-coding downstream 267543 17310332 ~ 17314262 (-)
G1908604 LOC106612819 non-coding downstream 272702 17306581 ~ 17309103 (-)
G1908551 LOC106612827 non-coding downstream 348101 17230892 ~ 17233704 (-)
G1908791 NA non-coding upstream 1636 17583754 ~ 17584118 (-)
G1908792 NA non-coding upstream 2406 17584524 ~ 17584789 (-)
G1908803 NA non-coding upstream 33139 17615257 ~ 17615495 (-)
G1908804 NA non-coding upstream 33809 17615927 ~ 17616140 (-)
G1908811 NA non-coding upstream 43818 17625936 ~ 17626204 (-)
G1907951 NA other downstream 1420579 16158846 ~ 16161226 (-)
G1907922 NA other downstream 1449243 16131990 ~ 16132562 (-)
LOC110503846 NA other downstream 1537500 16036987 ~ 16044740 (-)
G1906218 NA other downstream 2068712 15512359 ~ 15513093 (-)
LOC110503924 LOC107554284 other upstream 849906 18432024 ~ 18434798 (-)
LOC110503944 LOC106612932 other upstream 1385944 18968062 ~ 19185772 (-)
G1910398 NA other upstream 1578331 19160449 ~ 19162158 (-)
G1910539 NA other upstream 1750723 19332841 ~ 19333225 (-)
G1910651 NA other upstream 1908599 19490717 ~ 19491608 (-)

Expression


G1908789 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 4.
End of interactive chart.

G1908789 Expression in each Bioproject

Bar chart with 18 bars.
G1908789 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 40.
End of interactive chart.

Co-expression Network