G1910664


Basic Information

Item Value
gene id G1910664
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information

Item Value
chromosome id NC_048588.1
NCBI id CM023242.2
chromosome length 45930806
location 19509703 ~ 19510518 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence

>TU2185132
ACTTGGTTTTGATGAATCGTAATGATTCCATGTAAGGAAAAATGAACAGATAGGCTCCAGATTTACAGTAAAGGCAGCACACATAGGAGTTACTCTATAAAAGTGAGCTATTGCTGTAAGTGAGCAGCAGTTGACGTGGTTTTGTCATTATCAGAAACTGAAGTGTACACATTCACTTCCTAAACTGAAGTGTACACATTCACTTCCTAAACTGAAGTGTACACATTCACTTCCTAAACTGAAGTGTACACATTCACTTCCTAAACTGAAGTGTACACATTCACTTCCTAAACTGAAGTGTACACATTCACTTCCTAAACTGAAGTGTACACATTCACTTCCTAAACTGAAGTGTACACATTCACTTCCTAAACGGAAGTGTACACATTCACTTCCTATACTGAAATGTACACATTCACTTCCTAAACTGAAATGCTGAGAGTGAGAAAAATAAAGATACAGATATGGATATGTTTTCGTGTTGCCGGCTTCCATAAGAAATGTTCCAGAGGTGGTGTGTGCAGTGTTTTAAACAAAGCGGAGTGAACATTTTGCAAGTATGATGAACAGCAGGTATACTGTAAACCTGTGGAGGCAGAAGACGAGTCCAAAAAAAGATGTGTCTTCGAGCTCCCATTCGGCCCAGTCATATAA

Function

NR:

description
Small proline-rich protein 2H

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU2185132 True 654 lncRNA 0.39 2 19509703 19510518

Neighbor

gene id symbol gene type direction distance location
dph1 dph1 coding upstream 214216 19190189 ~ 19295487 (+)
rpa1 LOC106612933 coding upstream 635716 18819228 ~ 18873987 (+)
slc47a4 LOC106612938 coding upstream 752366 18747284 ~ 18757337 (+)
pitpnm3 pitpnm3 coding upstream 778317 18600404 ~ 18731396 (+)
kiaa0753 LOC106612783 coding upstream 916490 18564659 ~ 18593213 (+)
taok1a LOC106613037 coding downstream 34729 19545247 ~ 19576519 (+)
LOC110503952 LOC106581163 coding downstream 71107 19581625 ~ 19586824 (+)
LOC110503951 LOC106613034 coding downstream 79444 19589962 ~ 19610435 (+)
LOC100499594 socs5 coding downstream 100304 19610822 ~ 19615268 (+)
LOC110503363 LOC106613031 coding downstream 198821 19709339 ~ 19860123 (+)
G1910663 NA non-coding upstream 11172 19498332 ~ 19498531 (+)
G1910655 NA non-coding upstream 12658 19496759 ~ 19497045 (+)
G1910632 NA non-coding upstream 33596 19475752 ~ 19476107 (+)
G1910607 NA non-coding upstream 82547 19426300 ~ 19427156 (+)
G1910603 NA non-coding upstream 95234 19414064 ~ 19414469 (+)
G1910666 NA non-coding downstream 2091 19512609 ~ 19512915 (+)
G1910667 NA non-coding downstream 4150 19514668 ~ 19514920 (+)
G1910668 NA non-coding downstream 4464 19514982 ~ 19515422 (+)
G1910670 NA non-coding downstream 6664 19517182 ~ 19517492 (+)
G1910661 NA non-coding downstream 67798 19578316 ~ 19581366 (+)
G1909739 wdr81 other upstream 712425 18789221 ~ 18797278 (+)
G1909273 kiaa0100 other upstream 1035876 18473203 ~ 18473827 (+)
G1909262 NA other upstream 1055996 18450694 ~ 18453707 (+)
LOC110503911 nek8 other upstream 1399124 18090022 ~ 18110579 (+)
G1909085 NA other upstream 1403412 18099382 ~ 18106291 (+)
G1910697 NA other downstream 108900 19619418 ~ 19619730 (+)
G1911460 LOC105030512 other downstream 773802 20284320 ~ 20286066 (+)
G1911474 NA other downstream 794245 20304763 ~ 20307392 (+)
G1912565 LOC106612993 other downstream 1690618 21201136 ~ 21202449 (+)
sacs LOC106612984 other downstream 2149644 21648371 ~ 21683308 (+)

Expression

G1910664 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 1.5.
End of interactive chart.

G1910664 Expression in each Bioproject

Bar chart with 10 bars.
G1910664 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 25.
End of interactive chart.

Co-expression Network