G1914529 (LOC105899807)



Basic Information


Item Value
gene id G1914529
gene name LOC105899807
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048588.1
NCBI id CM023242.2
chromosome length 45930806
location 22762250 ~ 22762507 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU2189450
GTTCCTTTCCAGGTAAGTGGACAGCCTCTGTGCTATTATACTGAAAAATATCTTCCCTTCGACGTTGAGAAGGGAGATTGGTCGGAATTGACTGATGTCTGTCGCATCCTTCTCTTTCGGGATTAGCACACCACCAGCCCTTCGCCATGCCTTTGGTATTATTTCCTTCTGCCACACTATCCTCATGAGCCTCCAAAGAAAGCGTAGAACATCCGGGGCGTTCTTGTAGAGCTTGTATGGTACTCCATTAGGCCCAGG

Function


NR:

description
PREDICTED: uncharacterized protein LOC105899807

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU2189450 True 258 lncRNA 0.48 1 22762250 22762507

Neighbor


gene id symbol gene type direction distance location
LOC110504032 LOC106612968 coding upstream 444310 22304617 ~ 22317940 (+)
LOC110504031 LOC100195238 coding upstream 468390 22291019 ~ 22293860 (+)
LOC110504024 LOC106612975 coding upstream 883532 21872706 ~ 21878718 (+)
lbhl NA coding upstream 897649 21860032 ~ 21864601 (+)
cfap45 LOC106612979 coding upstream 1026139 21730610 ~ 21736111 (+)
LOC118944002 LOC100136491 coding downstream 179124 22941631 ~ 22969858 (+)
LOC118944012 NA coding downstream 286313 23048820 ~ 23052240 (+)
LOC110504034 LOC106612965 coding downstream 322535 23085042 ~ 23119468 (+)
LOC110504037 LOC106612964 coding downstream 389729 23152236 ~ 23187266 (+)
LOC110504039 LOC100380712 coding downstream 551896 23314175 ~ 23330065 (+)
G1914528 NA non-coding upstream 2424 22759617 ~ 22759826 (+)
G1914514 NA non-coding upstream 12054 22749893 ~ 22750196 (+)
G1914495 NA non-coding upstream 21404 22740643 ~ 22740846 (+)
G1914448 NA non-coding upstream 59324 22702633 ~ 22702926 (+)
G1914447 NA non-coding upstream 60290 22701685 ~ 22701960 (+)
G1914531 NA non-coding downstream 382 22762889 ~ 22763103 (+)
G1914584 NA non-coding downstream 29612 22792119 ~ 22792392 (+)
G1914594 NA non-coding downstream 35125 22797632 ~ 22797836 (+)
G1914616 NA non-coding downstream 58984 22821491 ~ 22829564 (+)
G1914823 NA non-coding downstream 192601 22955108 ~ 22955453 (+)
G1913153 NA other upstream 567643 22193790 ~ 22194607 (+)
sacs LOC106612984 other upstream 1100552 21648371 ~ 21683308 (+)
G1912565 LOC106612993 other upstream 1559801 21201136 ~ 21202449 (+)
G1911474 NA other upstream 2454858 20304763 ~ 20307392 (+)
G1911460 LOC105030512 other upstream 2476184 20284320 ~ 20286066 (+)
G1915361 LOC106611080 other downstream 662682 23425189 ~ 23426072 (+)
G1916129 NA other downstream 1249758 24012265 ~ 24012808 (+)
G1916588 NA other downstream 1755853 24518360 ~ 24519017 (+)
G1916660 NA other downstream 1879191 24641698 ~ 24642134 (+)
G1916811 NA other downstream 2162627 24925134 ~ 24927054 (+)

Expression


G1914529(LOC105899807) Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 30.
End of interactive chart.

G1914529(LOC105899807) Expression in each Bioproject

Bar chart with 19 bars.
G1914529(LOC105899807) Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 400.
End of interactive chart.

Co-expression Network