G1915199



Basic Information


Item Value
gene id G1915199
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048588.1
NCBI id CM023242.2
chromosome length 45930806
location 23125096 ~ 23129306 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU2190162
gaattgaaccctgtggtacccccatagagactgccagaggtccggacaacaggccctccgatttgacacactgaactctgtctgcaaagtagttggtgaaccaggcgaggcagtcatttgagaaaccaaggctattgagtctgctgacaagaatacggtgattgacagagtcgaaagccttggccaggtcgatgaagacgactgcacagtactgtcttttatcgatggcggttatgatatcgtttagtaccttgagcgtggctgaggtgcacccgtgaccggctcggaaaccggattgcacagcggagaaggtacgttggaattcgaaatggtcagtgatctgtttattaacttggctttcgaagactttagagaggcagggcaggatagatataggtctatagcagttttggtctagagtgaagaggggatgactgcggcagttttccaatctttagggatctcggacg

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU2190162 True 470 lncRNA 0.50 2 23125096 23129306
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110504033 LOC106612966 coding downstream 76355 22999057 ~ 23048741 (-)
LOC110503369 LOC106612967 coding downstream 448820 22462266 ~ 22676276 (-)
mxh LOC106612969 coding downstream 859595 22246578 ~ 22265501 (-)
LOC110504029 LOC106612970 coding downstream 951297 22081435 ~ 22173799 (-)
LOC110504027 LOC106612972 coding downstream 1137600 21899621 ~ 21987496 (-)
LOC110504036 LOC106581096 coding upstream 10661 23139967 ~ 23144967 (-)
LOC110504038 LOC106612963 coding upstream 97491 23226797 ~ 23295189 (-)
LOC110503370 LOC106581078 coding upstream 152577 23281883 ~ 23300679 (-)
LOC110504040 LOC106612962 coding upstream 200813 23330119 ~ 23341771 (-)
LOC110504042 LOC106612961 coding upstream 222806 23352112 ~ 23358660 (-)
G1915179 LOC106612965 non-coding downstream 27510 23091134 ~ 23097586 (-)
G1915166 NA non-coding downstream 50907 23073946 ~ 23074189 (-)
G1915162 NA non-coding downstream 58372 23066357 ~ 23066724 (-)
G1915136 NA non-coding downstream 67079 23010265 ~ 23058017 (-)
G1915207 NA non-coding upstream 72819 23202125 ~ 23202459 (-)
G1915254 NA non-coding upstream 90280 23219586 ~ 23219798 (-)
G1915279 NA non-coding upstream 166364 23295670 ~ 23295905 (-)
G1915288 NA non-coding upstream 179531 23308837 ~ 23309911 (-)
G1915296 NA non-coding upstream 182211 23311517 ~ 23312147 (-)
G1913663 NA other downstream 1252947 21871253 ~ 21872149 (-)
G1913665 NA other downstream 1260822 21863588 ~ 21864274 (-)
G1912470 NA other downstream 2148860 20972679 ~ 20976236 (-)
G1911862 NA other downstream 2663659 20460668 ~ 20461437 (-)
G1910996 NA other downstream 3433583 19691066 ~ 19691513 (-)
G1915836 NA other upstream 622537 23751843 ~ 23752463 (-)
LOC110504083 NA other upstream 3034159 26163462 ~ 26165289 (-)
LOC110503381 LOC106613064 other upstream 3081110 26208892 ~ 26241410 (-)
LOC110504098 LOC106613118 other upstream 3781478 26910083 ~ 26935725 (-)
G1919707 NA other upstream 4200144 27329450 ~ 27331899 (-)

Expression


G1915199 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 15.
End of interactive chart.

G1915199 Expression in each Bioproject

Bar chart with 21 bars.
G1915199 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 400.
End of interactive chart.

Co-expression Network