G1921456



Basic Information


Item Value
gene id G1921456
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048588.1
NCBI id CM023242.2
chromosome length 45930806
location 29089318 ~ 29089557 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU2197305
TGGAGAACCTCAGTTGAGTTGTAGTTTTCAGGGCTCCTCAATATGCCCTTCAATTATAAGCAACACTGCTCTGACTCCAGTGTCTATTAACCCTCACAGGATTAGCTTTAACAGATGTACTAGTAGAGGAGAGTGTTGGCCAGAGTCATGGACTTCAGTAATTTAACACTACTGTGAGTGGGCCTGACTGACTCCAGCATCTAAACTGCCCATTACTTATGTTGAGCATCACAGCCTGCA

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU2197305 True 240 lncRNA 0.45 1 29089318 29089557

Neighbor


gene id symbol gene type direction distance location
LOC110504129 LOC106613156 coding upstream 49710 29026037 ~ 29039608 (+)
LOC110503390 efhd1 coding upstream 145878 28927758 ~ 28943440 (+)
trnag-ucc-230 NA coding upstream 161693 28927554 ~ 28927625 (+)
trnap-agg-155 NA coding upstream 168003 28921244 ~ 28921315 (+)
trnai-aau-84 NA coding upstream 173010 28916235 ~ 28916308 (+)
LOC110503387 fat3 coding downstream 222428 29311985 ~ 29659405 (+)
LOC118944007 NA coding downstream 574620 29664177 ~ 29751463 (+)
LOC110504126 LOC106613152 coding downstream 694861 29784418 ~ 29786182 (+)
LOC110503157 LOC106592784 coding downstream 1335478 30425035 ~ 30429010 (+)
LOC110503160 ilk coding downstream 1386435 30475992 ~ 30497130 (+)
G1921435 NA non-coding upstream 13299 29075807 ~ 29076019 (+)
G1921431 NA non-coding upstream 17551 29071296 ~ 29071767 (+)
G1921421 NA non-coding upstream 28149 29060867 ~ 29061169 (+)
G1921382 NA non-coding upstream 46332 29042374 ~ 29042986 (+)
G1921381 NA non-coding upstream 49234 29039785 ~ 29040084 (+)
G1921480 NA non-coding downstream 18895 29108452 ~ 29108689 (+)
G1921484 NA non-coding downstream 22283 29111840 ~ 29112125 (+)
G1921495 LOC100380853 non-coding downstream 34071 29123628 ~ 29123960 (+)
G1921538 NA non-coding downstream 83354 29172911 ~ 29173125 (+)
G1921543 NA non-coding downstream 86645 29176202 ~ 29176402 (+)
G1920101 LOC106613131 other upstream 1266568 27820794 ~ 27822750 (+)
G1919949 NA other upstream 1470855 27617023 ~ 27618463 (+)
G1919459 NA other upstream 2034103 27054908 ~ 27055215 (+)
G1919064 LOC106613117 other upstream 2046044 27036345 ~ 27043274 (+)
G1922041 LOC106613152 other downstream 620323 29709880 ~ 29785287 (+)
G1922637 NA other downstream 1198002 30287559 ~ 30289340 (+)
G1923728 NA other downstream 2192386 31281943 ~ 31282157 (+)
G1923824 NA other downstream 2364773 31454330 ~ 31455689 (+)
G1924021 NA other downstream 2813970 31903527 ~ 31908662 (+)

Expression


G1921456 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 1.5.
End of interactive chart.

G1921456 Expression in each Bioproject

Bar chart with 6 bars.
G1921456 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 10.
End of interactive chart.

Co-expression Network