G1921495 (LOC100380853)



Basic Information


Item Value
gene id G1921495
gene name LOC100380853
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048588.1
NCBI id CM023242.2
chromosome length 45930806
location 29123628 ~ 29123960 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU2197346
gtaccttcgccccgctggacactgaggaggcgcgggttcagcccgtaacgcccgctcgatgtccgagtccacctcccataccactggggctaccagcttcgaggcgggaaggatgggagtaggttcggtggacccatcctccgtgtcataaaggcgggacagtgcgtcagccttcacgttctgggagcctggtctataagacaaagtaaatcggaaccgggtgaagaacatggcccaccttgcctgacgtgggttaagtctcctagctgcccgaatatactccagattctggtggtcggtccagatgagaaaggggtgtttagccccctcaag

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU2197346 True 333 lncRNA 0.59 1 29123628 29123960

Neighbor


gene id symbol gene type direction distance location
LOC110504129 LOC106613156 coding upstream 84020 29026037 ~ 29039608 (+)
LOC110503390 efhd1 coding upstream 180188 28927758 ~ 28943440 (+)
trnag-ucc-230 NA coding upstream 196003 28927554 ~ 28927625 (+)
trnap-agg-155 NA coding upstream 202313 28921244 ~ 28921315 (+)
trnai-aau-84 NA coding upstream 207320 28916235 ~ 28916308 (+)
LOC110503387 fat3 coding downstream 188025 29311985 ~ 29659405 (+)
LOC118944007 NA coding downstream 540217 29664177 ~ 29751463 (+)
LOC110504126 LOC106613152 coding downstream 660458 29784418 ~ 29786182 (+)
LOC110503157 LOC106592784 coding downstream 1301075 30425035 ~ 30429010 (+)
LOC110503160 ilk coding downstream 1352032 30475992 ~ 30497130 (+)
G1921484 NA non-coding upstream 11503 29111840 ~ 29112125 (+)
G1921480 NA non-coding upstream 14939 29108452 ~ 29108689 (+)
G1921456 NA non-coding upstream 34071 29089318 ~ 29089557 (+)
G1921435 NA non-coding upstream 47609 29075807 ~ 29076019 (+)
G1921431 NA non-coding upstream 51861 29071296 ~ 29071767 (+)
G1921538 NA non-coding downstream 48951 29172911 ~ 29173125 (+)
G1921543 NA non-coding downstream 52242 29176202 ~ 29176402 (+)
G1921544 NA non-coding downstream 52551 29176511 ~ 29176738 (+)
G1921545 NA non-coding downstream 56351 29180311 ~ 29180710 (+)
G1921593 NA non-coding downstream 110293 29234253 ~ 29235161 (+)
G1920101 LOC106613131 other upstream 1300878 27820794 ~ 27822750 (+)
G1919949 NA other upstream 1505165 27617023 ~ 27618463 (+)
G1919459 NA other upstream 2068413 27054908 ~ 27055215 (+)
G1919064 LOC106613117 other upstream 2080354 27036345 ~ 27043274 (+)
G1922041 LOC106613152 other downstream 585920 29709880 ~ 29785287 (+)
G1922637 NA other downstream 1163599 30287559 ~ 30289340 (+)
G1923728 NA other downstream 2157983 31281943 ~ 31282157 (+)
G1923824 NA other downstream 2330370 31454330 ~ 31455689 (+)
G1924021 NA other downstream 2779567 31903527 ~ 31908662 (+)

Expression


G1921495(LOC100380853) Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 40.
End of interactive chart.

G1921495(LOC100380853) Expression in each Bioproject

Bar chart with 16 bars.
G1921495(LOC100380853) Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 600.
End of interactive chart.

Co-expression Network