G1921545



Basic Information


Item Value
gene id G1921545
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048588.1
NCBI id CM023242.2
chromosome length 45930806
location 29180311 ~ 29180710 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU2197396
GATCCCTTGCTTTACTGAGGCCCTGCTGTACTGAGGCCCTGCTGTACTGATCCCCTGCTGTATTGTGGCCCTGCTTTACTGTGGCCCTGCTGTAATGATTCCCTGATGTACTGAGGCCCTGCTTTACTGAGGCCCTAGTTTACTGAGACCCTGCTGTACTGAGGCCCTGTGGTATTGATCCTCTGCTGTACTGAGGCCCTGCATTCGGAGGACCTGCTGTACTGAGGCCCTGATATACTGATCCCCTGCTGTACTGAGGCCCTGCTGTACTGATCCCTTGCTTTACTGAGGCTCTGCTGTACTGATGCCCTGCTGAACTGATCCCTTGCTTTACTGAGGCTCTGCTGTACTGAGGCCCTGCCATACTGAGACCCTGCTGTACTGAGGCCCTGCTGTACGG

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU2197396 True 400 lncRNA 0.55 1 29180311 29180710

Neighbor


gene id symbol gene type direction distance location
LOC110504129 LOC106613156 coding upstream 140703 29026037 ~ 29039608 (+)
LOC110503390 efhd1 coding upstream 236871 28927758 ~ 28943440 (+)
trnag-ucc-230 NA coding upstream 252686 28927554 ~ 28927625 (+)
trnap-agg-155 NA coding upstream 258996 28921244 ~ 28921315 (+)
trnai-aau-84 NA coding upstream 264003 28916235 ~ 28916308 (+)
LOC110503387 fat3 coding downstream 131275 29311985 ~ 29659405 (+)
LOC118944007 NA coding downstream 483467 29664177 ~ 29751463 (+)
LOC110504126 LOC106613152 coding downstream 603708 29784418 ~ 29786182 (+)
LOC110503157 LOC106592784 coding downstream 1244325 30425035 ~ 30429010 (+)
LOC110503160 ilk coding downstream 1295282 30475992 ~ 30497130 (+)
G1921544 NA non-coding upstream 3573 29176511 ~ 29176738 (+)
G1921543 NA non-coding upstream 3909 29176202 ~ 29176402 (+)
G1921538 NA non-coding upstream 7186 29172911 ~ 29173125 (+)
G1921495 LOC100380853 non-coding upstream 56351 29123628 ~ 29123960 (+)
G1921484 NA non-coding upstream 68186 29111840 ~ 29112125 (+)
G1921593 NA non-coding downstream 53543 29234253 ~ 29235161 (+)
G1921599 NA non-coding downstream 56501 29237211 ~ 29237761 (+)
G1921602 NA non-coding downstream 60466 29241176 ~ 29241402 (+)
G1921612 NA non-coding downstream 66713 29247423 ~ 29247629 (+)
G1921663 NA non-coding downstream 145741 29326451 ~ 29330876 (+)
G1920101 LOC106613131 other upstream 1357561 27820794 ~ 27822750 (+)
G1919949 NA other upstream 1561848 27617023 ~ 27618463 (+)
G1919459 NA other upstream 2125096 27054908 ~ 27055215 (+)
G1919064 LOC106613117 other upstream 2137037 27036345 ~ 27043274 (+)
G1922041 LOC106613152 other downstream 529170 29709880 ~ 29785287 (+)
G1922637 NA other downstream 1106849 30287559 ~ 30289340 (+)
G1923728 NA other downstream 2101233 31281943 ~ 31282157 (+)
G1923824 NA other downstream 2273620 31454330 ~ 31455689 (+)
G1924021 NA other downstream 2722817 31903527 ~ 31908662 (+)

Expression


G1921545 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 2.
End of interactive chart.

G1921545 Expression in each Bioproject

Bar chart with 1 bar.
G1921545 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 30.
End of interactive chart.

Co-expression Network