G1924664



Basic Information


Item Value
gene id G1924664
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048588.1
NCBI id CM023242.2
chromosome length 45930806
location 32224494 ~ 32224748 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU2200780
AAGCAACCACACGTTTGTCTTGGTCGTATTTTTGGTACAACCCAGCGCTAACGCAGTGCTCTGAGAAACCGACTTCCAAAAATAATGTCTTGTCTTTGTTGGGGTATACCAGGCAGGGTGCCTCACAAAGCAGGTTTTTCAAGGAAGCCACAGCTTCGTTGTGAGTCCCAAACGAATGGGGTGTCTTTCTGAAGAAGACGAGTCAACAGTTTTGACAAGTCGGCGTAGTTTTCGATGAATTGACAGGAGTAATTA

Function


NR:

description
uncharacterized protein LOC111188456

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU2200780 True 255 lncRNA 0.45 1 32224494 32224748
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110503171 LOC106613199 coding downstream 78009 32144469 ~ 32146485 (-)
LOC110503169 LOC106613189 coding downstream 94746 32118829 ~ 32129748 (-)
LOC110503167 stim1 coding downstream 117461 32050391 ~ 32107033 (-)
LOC110503164 rblce coding downstream 287206 31936281 ~ 31937288 (-)
LOC110503394 LOC106581381 coding downstream 323983 31293956 ~ 31900511 (-)
LOC110503475 NA coding upstream 47568 32272316 ~ 32275256 (-)
aasdhppt aasdhppt coding upstream 227661 32452409 ~ 32464742 (-)
gria4a gria4 coding upstream 251732 32476435 ~ 32635735 (-)
LOC110503410 LOC106613204 coding upstream 686416 32911164 ~ 32919166 (-)
LOC110503411 dync2h1 coding upstream 701830 32926578 ~ 33152283 (-)
G1924656 NA non-coding downstream 6252 32218005 ~ 32218242 (-)
G1924616 NA non-coding downstream 57208 32167067 ~ 32167286 (-)
G1924571 LOC106613188 non-coding downstream 89379 32134867 ~ 32135115 (-)
G1924567 LOC106613190 non-coding downstream 106950 32115307 ~ 32117544 (-)
G1924564 NA non-coding downstream 116665 32107624 ~ 32107829 (-)
G1924677 NA non-coding upstream 9893 32234641 ~ 32234967 (-)
G1924694 NA non-coding upstream 35150 32259898 ~ 32260109 (-)
G1924902 NA non-coding upstream 64419 32289167 ~ 32290007 (-)
G1924903 NA non-coding upstream 70811 32295559 ~ 32296323 (-)
G1924912 NA non-coding upstream 80844 32305592 ~ 32305832 (-)
G1924540 LOC106581383 other downstream 184289 32038923 ~ 32040205 (-)
G1924470 NA other downstream 315903 31903633 ~ 31908591 (-)
LOC110503392 LOC106613147 other downstream 1913941 30307882 ~ 30310553 (-)
G1922783 NA other downstream 1922451 30301617 ~ 30302043 (-)
G1925165 NA other upstream 523133 32747881 ~ 32748126 (-)
LOC110503210 grm5 other upstream 1352957 33449765 ~ 33582717 (-)
G1926633 NA other upstream 2085560 34310308 ~ 34311965 (-)
G1927182 LOC106581473 other upstream 2691511 34916259 ~ 34925330 (-)
G1927252 NA other upstream 2744321 34969069 ~ 34969720 (-)

Expression


G1924664 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 4.
End of interactive chart.

G1924664 Expression in each Bioproject

Bar chart with 6 bars.
G1924664 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 70.
End of interactive chart.

Co-expression Network