G1925598



Basic Information


Item Value
gene id G1925598
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048588.1
NCBI id CM023242.2
chromosome length 45930806
location 33156036 ~ 33157008 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU2201871
ggttaggagaattaacgctgcaggttaggagaattaacacagcaggttaggagaattaacgcagcaggttaggagaattaacgctgcaggttaggagaattaacgcagcaggttaggagaattaacgcagcaggttaggagaattaacgcagcaggttaggagaattaacgctgcaggttaggagaattaacacagcaggttaggagaattaacgcagcaggttaggagaattaacgctgcaggttaggagaattaacgcagcaggttaggagaattaacgcagcaggttaggagaattaacgcagcaggtta

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU2201871 True 313 lncRNA 0.45 2 33156036 33157008
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110503411 dync2h1 coding downstream 3753 32926578 ~ 33152283 (-)
LOC110503410 LOC106613204 coding downstream 236870 32911164 ~ 32919166 (-)
gria4a gria4 coding downstream 520301 32476435 ~ 32635735 (-)
aasdhppt aasdhppt coding downstream 691294 32452409 ~ 32464742 (-)
LOC110503475 NA coding downstream 880780 32272316 ~ 32275256 (-)
LOC118944036 NA coding upstream 27648 33184656 ~ 33185144 (-)
LOC110503412 rab38 coding upstream 232282 33389290 ~ 33410184 (-)
ctsc LOC100136230 coding upstream 253341 33410349 ~ 33416640 (-)
LOC110503210 grm5 coding upstream 292757 33449765 ~ 33582717 (-)
LOC110503182 LOC106613230 coding upstream 479119 33636127 ~ 33639797 (-)
G1925570 NA non-coding downstream 10871 33098655 ~ 33145165 (-)
G1925557 NA non-coding downstream 77330 33077972 ~ 33078706 (-)
G1925546 NA non-coding downstream 114690 33039951 ~ 33041346 (-)
G1925542 NA non-coding downstream 119003 33036314 ~ 33037033 (-)
G1925543 NA non-coding downstream 120294 33035168 ~ 33035742 (-)
G1926017 NA non-coding upstream 176137 33333145 ~ 33334545 (-)
G1926027 NA non-coding upstream 185583 33342591 ~ 33350248 (-)
G1926123 NA non-coding upstream 372120 33529128 ~ 33538617 (-)
G1926125 NA non-coding upstream 375128 33532136 ~ 33535007 (-)
G1926145 NA non-coding upstream 419937 33576945 ~ 33577344 (-)
G1925165 NA other downstream 407910 32747881 ~ 32748126 (-)
G1924540 LOC106581383 other downstream 1115831 32038923 ~ 32040205 (-)
G1924470 NA other downstream 1247445 31903633 ~ 31908591 (-)
LOC110503394 LOC106581381 other downstream 1840606 31293956 ~ 31900511 (-)
LOC110503392 LOC106613147 other downstream 2845483 30307882 ~ 30310553 (-)
G1926633 NA other upstream 1153300 34310308 ~ 34311965 (-)
G1927182 LOC106581473 other upstream 1759251 34916259 ~ 34925330 (-)
G1927252 NA other upstream 1812061 34969069 ~ 34969720 (-)
G1927787 NA other upstream 2322258 35479266 ~ 35479540 (-)

Expression


G1925598 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 8.
End of interactive chart.

G1925598 Expression in each Bioproject

Bar chart with 16 bars.
G1925598 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 150.
End of interactive chart.

Co-expression Network