G1926027



Basic Information


Item Value
gene id G1926027
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048588.1
NCBI id CM023242.2
chromosome length 45930806
location 33342591 ~ 33350248 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU2202383
accattccattgtagattttgctttatgttttggatcattgtcttgttggaagacaaatctccgtcccagtctcaggtcttttgcagactccatcaggttttcttccagaagggtcctgtatttggctccatccatcttcccatcaattttaaccatcttccctgtccctgctgaagaaaagcaggcccaaaccatgatgctgccaccaccatgtttgacagtggggatggtgtgttcagctgtgttgcttttacgccaaacataacgttttgcattgttgccaaaaagttcaattttggtttcgtctgaccagagcaccttcttccacatgtttggtgtgtctcccaggtggcttgtggcaaactttaaacaacactttttatggatttctttaagaaatggctttcttcttgccactcttccataaaggccagatttgtgcaatatacgactgattgttgtcctatggacagagtctcccacctcagctgtagatctctgcagttcatccagagtgatcatgggcctcttggctgcatctctgatcagt

Function


NR:

description
Tc1-like transporase

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU2202383 True 551 lncRNA 0.44 2 33342591 33350248

Neighbor


gene id symbol gene type direction distance location
LOC118944036 NA coding downstream 157447 33184656 ~ 33185144 (-)
LOC110503411 dync2h1 coding downstream 190308 32926578 ~ 33152283 (-)
LOC110503410 LOC106613204 coding downstream 423425 32911164 ~ 32919166 (-)
gria4a gria4 coding downstream 706856 32476435 ~ 32635735 (-)
aasdhppt aasdhppt coding downstream 877849 32452409 ~ 32464742 (-)
LOC110503412 rab38 coding upstream 39042 33389290 ~ 33410184 (-)
ctsc LOC100136230 coding upstream 60101 33410349 ~ 33416640 (-)
LOC110503210 grm5 coding upstream 99517 33449765 ~ 33582717 (-)
LOC110503182 LOC106613230 coding upstream 285879 33636127 ~ 33639797 (-)
numa1 numa1 coding upstream 297241 33647489 ~ 33665998 (-)
G1926017 NA non-coding downstream 8046 33333145 ~ 33334545 (-)
G1925598 NA non-coding downstream 185583 33156036 ~ 33157008 (-)
G1925570 NA non-coding downstream 197426 33098655 ~ 33145165 (-)
G1925557 NA non-coding downstream 263885 33077972 ~ 33078706 (-)
G1925546 NA non-coding downstream 301245 33039951 ~ 33041346 (-)
G1926123 NA non-coding upstream 178880 33529128 ~ 33538617 (-)
G1926125 NA non-coding upstream 181888 33532136 ~ 33535007 (-)
G1926145 NA non-coding upstream 226697 33576945 ~ 33577344 (-)
G1926147 NA non-coding upstream 236942 33587190 ~ 33587413 (-)
G1926161 NA non-coding upstream 256699 33606947 ~ 33607291 (-)
G1925165 NA other downstream 594465 32747881 ~ 32748126 (-)
G1924540 LOC106581383 other downstream 1302386 32038923 ~ 32040205 (-)
G1924470 NA other downstream 1434000 31903633 ~ 31908591 (-)
LOC110503394 LOC106581381 other downstream 2027161 31293956 ~ 31900511 (-)
LOC110503392 LOC106613147 other downstream 3032038 30307882 ~ 30310553 (-)
G1926633 NA other upstream 960060 34310308 ~ 34311965 (-)
G1927182 LOC106581473 other upstream 1566011 34916259 ~ 34925330 (-)
G1927252 NA other upstream 1618821 34969069 ~ 34969720 (-)
G1927787 NA other upstream 2129018 35479266 ~ 35479540 (-)

Expression


G1926027 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 3.
End of interactive chart.

G1926027 Expression in each Bioproject

Bar chart with 21 bars.
G1926027 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 75.
End of interactive chart.

Co-expression Network