G1927313



Basic Information


Item Value
gene id G1927313
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048588.1
NCBI id CM023242.2
chromosome length 45930806
location 35082644 ~ 35082931 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU2203869
TCTTATTAGTGCTGTGGATGCTATTTTATTAGTGCTGTGGCTGCTATTTTATTAGTGCTGTGGCTGCTATTTTATTAGTGCTGTGGATGCTATCTTATTAGTGCTGTGGCTGCTATTTTATTAGTGCTGTGGATGCTATCTTATTAGTGCTGTGGATGCTATCTTATTAGTGCTGTGGATGCTATCTTATTAGTGCTGTGGCTGCTATTTTATTAGTGC

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU2203869 True 219 lncRNA 0.38 2 35082644 35082931
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110503233 LOC106581478 coding upstream 83144 34990271 ~ 34999500 (+)
LOC110503229 LOC106613265 coding upstream 196758 34872699 ~ 34885886 (+)
LOC110503420 LOC106613261 coding upstream 416345 34661742 ~ 34666299 (+)
LOC110503419 LOC106581479 coding upstream 434471 34640176 ~ 34648173 (+)
LOC110503217 LOC106613270 coding upstream 444443 34501674 ~ 34638201 (+)
LOC110503239 LOC106613303 coding downstream 227044 35309975 ~ 35331683 (+)
LOC110503247 LOC106613308 coding downstream 958625 36041556 ~ 36065654 (+)
LOC110503248 LOC106613310 coding downstream 1031956 36114887 ~ 36120364 (+)
LOC110503428 LOC106581496 coding downstream 1041891 36124822 ~ 36126220 (+)
LOC110503249 LOC106613309 coding downstream 1062093 36145024 ~ 36150522 (+)
G1927310 NA non-coding upstream 7643 35074263 ~ 35075001 (+)
G1927251 NA non-coding upstream 113238 34969146 ~ 34969406 (+)
G1927238 NA non-coding upstream 122097 34960272 ~ 34960547 (+)
G1927235 NA non-coding upstream 124292 34958026 ~ 34958352 (+)
G1927222 NA non-coding upstream 132471 34949867 ~ 34950173 (+)
G1927315 NA non-coding downstream 2837 35085768 ~ 35087483 (+)
G1927330 NA non-coding downstream 48136 35131067 ~ 35131362 (+)
G1927335 NA non-coding downstream 56326 35139257 ~ 35139642 (+)
G1927336 NA non-coding downstream 120952 35203883 ~ 35204334 (+)
G1927339 NA non-coding downstream 125921 35208852 ~ 35209289 (+)
G1926351 NA other upstream 1000909 34079223 ~ 34082461 (+)
G1925870 NA other upstream 1334391 33742659 ~ 33748253 (+)
G1925778 NA other upstream 1540712 33541189 ~ 33541932 (+)
G1925777 NA other upstream 1542163 33539938 ~ 33540481 (+)
G1927540 NA other downstream 296971 35379902 ~ 35381869 (+)
G1928169 NA other downstream 1058298 36141229 ~ 36170471 (+)
G1928170 NA other downstream 1083695 36166626 ~ 36169329 (+)
G1928430 NA other downstream 1578943 36661874 ~ 36662497 (+)
LOC110503264 LOC106581527 other downstream 1975075 36985873 ~ 37079320 (+)

Expression


G1927313 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 8.
End of interactive chart.

G1927313 Expression in each Bioproject

Bar chart with 6 bars.
G1927313 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 125.
End of interactive chart.

Co-expression Network