G1928179



Basic Information


Item Value
gene id G1928179
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048588.1
NCBI id CM023242.2
chromosome length 45930806
location 36159662 ~ 36161083 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU2204984
gctttgcacacacttggcattatctcaaccagcttcatgaggtagtcacctggaatgcatttcaattaacaggtgtgccttgttaaaagttaatttgtggaatttatttccttcttaatgcatttgagccaatcagttgtgttgtgacaaggtaggggtggtatacagaagatagccctatttggtaaaagaccaagtccatattatggcaagaacagctcaaatatgcaaagagaaacaacagtccatcattacattaaggcatgaaggtcagtcaatgaggaacattttaagaactttaaatgcagtcgcaaaaaccatcaagcactatgatg

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU2204984 True 335 lncRNA 0.38 2 36159662 36161083

Neighbor


gene id symbol gene type direction distance location
LOC110503249 LOC106613309 coding upstream 9140 36145024 ~ 36150522 (+)
LOC110503428 LOC106581496 coding upstream 33442 36124822 ~ 36126220 (+)
LOC110503248 LOC106613310 coding upstream 39298 36114887 ~ 36120364 (+)
LOC110503247 LOC106613308 coding upstream 94008 36041556 ~ 36065654 (+)
LOC110503239 LOC106613303 coding upstream 827979 35309975 ~ 35331683 (+)
wdr53 wdr53 coding downstream 2260 36163343 ~ 36166464 (+)
LOC110503252 LOC106581503 coding downstream 19476 36180559 ~ 36218330 (+)
LOC110503435 LOC106581515 coding downstream 94809 36255892 ~ 36413741 (+)
LOC110517470 sh2b2 coding downstream 273875 36434958 ~ 36498284 (+)
bud23 wbscr22 coding downstream 344805 36505888 ~ 36512484 (+)
G1928177 NA non-coding upstream 4264 36151931 ~ 36155398 (+)
G1928176 NA non-coding upstream 11450 36146680 ~ 36148212 (+)
G1928142 NA non-coding upstream 56976 36102483 ~ 36102686 (+)
G1928133 NA non-coding upstream 61370 36097482 ~ 36098292 (+)
G1928170 NA non-coding downstream 6546 36166626 ~ 36169329 (+)
G1928196 NA non-coding downstream 48895 36209978 ~ 36211963 (+)
G1928239 NA non-coding downstream 61105 36222188 ~ 36222543 (+)
G1928258 NA non-coding downstream 80821 36241904 ~ 36242233 (+)
G1928263 NA non-coding downstream 87904 36248987 ~ 36252176 (+)
G1927540 NA other upstream 777793 35379902 ~ 35381869 (+)
LOC110503217 LOC106613270 other upstream 1522539 34501674 ~ 34638201 (+)
G1926351 NA other upstream 2077927 34079223 ~ 34082461 (+)
G1925870 NA other upstream 2411409 33742659 ~ 33748253 (+)
G1925778 NA other upstream 2617730 33541189 ~ 33541932 (+)
G1928430 NA other downstream 500791 36661874 ~ 36662497 (+)
LOC110503264 LOC106581527 other downstream 896923 36985873 ~ 37079320 (+)
urb1 urb1 other downstream 1012523 37125695 ~ 37191160 (+)
LOC110503265 scaf4 other downstream 1040776 37193636 ~ 37239498 (+)

Expression


G1928179 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 200.
End of interactive chart.

G1928179 Expression in each Bioproject

Bar chart with 21 bars.
G1928179 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 7500.
End of interactive chart.

Co-expression Network