G1928752



Basic Information


Item Value
gene id G1928752
gene name NA
gene type unknown
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048588.1
NCBI id CM023242.2
chromosome length 45930806
location 37434903 ~ 37435441 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU2205711
CCTACTCTCTCATCATGTTGGGTTAGGGATGGTCTCCCTACTCTCTCATCACATTGGGTTAGGGATGGTCTCCCTACTCTCTCATCACATTGGGTTAGGGATGGTCTCCCTACATCACATTGGGTTAGGGATGGTCTCCCTGCTCTCTCATCACATTGGGTTAGGGATGGTCTCCCTGCTCTCTCATCACATTGGGTTAGGGATGGTCTCCCTACATCACATTGGGTTAGGGATGGTCTCCCTGCTCTCTCATCACATTGGGTTAGGGATGGTCTCCCTGCTCTCTCATCACATTGGGTTAGGGATGGTCTCCCTACTCTCTCGTCACATTGGGTTAGGGATGGTCTCCCTACTCTCTCATCACATTGGGTTAGGGATGGTCTCCCTACTCTCTCATCACATTGGGTTAGGGATGGTCTCCCTACATCATGTTGGGTTAGGGATGGTCTCCCTACATCATGTCGGGTTAGGGATGGTCTCCCTACATCATGTTGGGTTAGGGATGGTCTCCCTGCTCTCTCATCACATTGGGTTAGGGA

Function


NR:

description
PREDICTED: S-antigen protein-like

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU2205711 True 539 TUCP 0.51 1 37434903 37435441

Neighbor


gene id symbol gene type direction distance location
LOC110503430 LOC106613330 coding upstream 2786 37431071 ~ 37432117 (+)
LOC110503254 LOC106613331 coding upstream 21230 37410129 ~ 37413673 (+)
LOC118944094 NA coding upstream 54682 37377737 ~ 37380221 (+)
LOC118944100 NA coding upstream 57694 37375591 ~ 37377209 (+)
LOC110503436 tiam1 coding upstream 59369 37291589 ~ 37375534 (+)
or112-1 LOC106613329 coding downstream 5385 37440826 ~ 37442646 (+)
LOC110511319 LOC106613336 coding downstream 511222 37946663 ~ 37973546 (+)
LOC118944107 NA coding downstream 541204 37976645 ~ 37979130 (+)
LOC110511668 LOC106591056 coding downstream 604422 38039863 ~ 38121778 (+)
rasgrp4 rasgrp4 coding downstream 1027994 38463435 ~ 38523166 (+)
G1928751 NA non-coding upstream 1509 37432916 ~ 37433394 (+)
G1928746 NA non-coding upstream 8545 37425846 ~ 37426358 (+)
G1928745 NA non-coding upstream 9251 37425298 ~ 37425652 (+)
G1928743 NA non-coding upstream 12019 37422546 ~ 37422884 (+)
G1928736 NA non-coding upstream 30970 37403731 ~ 37403933 (+)
G1928753 NA non-coding downstream 2285 37437726 ~ 37437961 (+)
G1928756 NA non-coding downstream 10120 37445561 ~ 37464638 (+)
G1928780 NA non-coding downstream 99742 37535183 ~ 37537378 (+)
G1928801 NA non-coding downstream 121362 37556803 ~ 37557291 (+)
G1928802 NA non-coding downstream 122191 37557632 ~ 37557962 (+)
LOC110503265 scaf4 other upstream 231717 37193636 ~ 37239498 (+)
urb1 urb1 other upstream 251381 37125695 ~ 37191160 (+)
LOC110503264 LOC106581527 other upstream 371359 36985873 ~ 37079320 (+)
G1928430 NA other upstream 772406 36661874 ~ 36662497 (+)
G1928851 NA other downstream 197774 37633215 ~ 37634159 (+)
G1929037 NA other downstream 762457 38197898 ~ 38198524 (+)
G1929196 NA other downstream 1074405 38509846 ~ 38513105 (+)

Expression


G1928752 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 1.5.
End of interactive chart.

G1928752 Expression in each Bioproject

Bar chart with 4 bars.
G1928752 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 25.
End of interactive chart.

Co-expression Network