G1930587



Basic Information


Item Value
gene id G1930587
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048588.1
NCBI id CM023242.2
chromosome length 45930806
location 37889246 ~ 37889613 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU2208147
GTCATAACCTGTATAAGTCTGGTCATAGCCAGTGTAAGTAAGGTCATAGCCAGTGTAAGTCATCTGTAAGTCAGGTCATAGCCTGTATAAGTCAGGTCATAGCCAGTGTAAGTCAGGTCATAGCCTGTATAAGTCAGGTCATAGCCAGTGTAAGTCATCTGTAAGTCAGATCATAGCCAGTGTAAGTCATCTGTAAGTCAGGTCATAGCCAGTGTAAGTCAGGTCATAGCCAGTGTAAGTCAGGTCATAGCCAGTGTAAGTCAGGTCATAGCCAGTGTAAGTTATCTGTAAGTC

Function


GO: NA

KEGG:

id description

RNA


RNA id representative length rna type GC content exon number start site end site
TU2208147 True 294 lncRNA 0.44 4 37889246 37889613
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110503255 LOC106613338 coding downstream 170974 37679493 ~ 37718272 (-)
LOC118944019 NA coding downstream 197016 37689230 ~ 37692230 (-)
LOC110503256 LOC106613340 coding downstream 210156 37664514 ~ 37679090 (-)
wdr62 LOC106613339 coding downstream 224957 37599847 ~ 37664289 (-)
LOC110503257 LOC106613341 coding downstream 289994 37537087 ~ 37599252 (-)
LOC118944103 LOC106613334 coding upstream 94506 37984081 ~ 38021354 (-)
LOC118944071 leg4 coding upstream 236753 38126366 ~ 38168485 (-)
LOC110503258 LOC105027022 coding upstream 294568 38184181 ~ 38196994 (-)
ryr1b LOC103368738 coding upstream 313127 38202740 ~ 38436340 (-)
hnrnpul1 LOC105027039 coding upstream 641815 38531428 ~ 38570785 (-)
G1930567 NA non-coding downstream 43325 37843085 ~ 37845921 (-)
G1930548 NA non-coding downstream 72269 37816639 ~ 37816977 (-)
G1930545 NA non-coding downstream 150852 37736753 ~ 37738394 (-)
G1930529 NA non-coding downstream 206470 37681732 ~ 37682776 (-)
G1930528 NA non-coding downstream 214529 37672541 ~ 37674717 (-)
G1930593 NA non-coding upstream 24191 37913804 ~ 37914480 (-)
G1930601 NA non-coding upstream 56519 37946132 ~ 37946367 (-)
G1930610 NA non-coding upstream 81537 37971150 ~ 37971511 (-)
G1930614 NA non-coding upstream 92109 37981722 ~ 37982264 (-)
G1930615 NA non-coding upstream 93281 37982894 ~ 38072900 (-)
G1930391 LOC103149469 other downstream 584781 37304014 ~ 37304465 (-)
G1930343 NA other downstream 671180 37216638 ~ 37218332 (-)
G1930333 NA other downstream 687323 37201438 ~ 37201923 (-)
G1930026 LOC106613311 other downstream 1331362 36554184 ~ 36557884 (-)
G1927929 NA other downstream 2098661 35789266 ~ 35790585 (-)
G1930684 NA other upstream 228211 38117824 ~ 38118432 (-)
G1930800 NA other upstream 583417 38473030 ~ 38474008 (-)
G1930841 NA other upstream 690804 38580417 ~ 38582296 (-)
G1930859 NA other upstream 762938 38616137 ~ 38656202 (-)

Expression


G1930587 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 15.
End of interactive chart.

G1930587 Expression in each Bioproject

Bar chart with 16 bars.
G1930587 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 75.
End of interactive chart.

Co-expression Network