G1930610



Basic Information


Item Value
gene id G1930610
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048588.1
NCBI id CM023242.2
chromosome length 45930806
location 37971150 ~ 37971511 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU2208171
GCTGTAGAATGTGTAGCTTTAGTTGGCTAAGTGAGAAGAAGTTAGCCAGCCTGCATACAGTAGGGTTTTTGTCCTCAGACGGAAGGATGAAGTAGTATGAATTTTACTTCTTAAAATAACATGCAGAACACATTAGAGGCTTCACGAGCGTCACCAGCATGTGCTGATTAAGTGAAAGTGCCACTTTTGTGATTGAACAGTAAGTATTCTAGGTATTGTTCGTGACCCTGTTTCACATTTGCTATTTTGGCACTGTGTTTCTGGGGCTAACCCCGAAAAGTCTGTGCTAACCCTGCTCCGGAGTAGGGCCAGCTAGCCGTGGACTAAGTTTGGTGCTAGCCGTGGACTAAGTTTGGTGCTAG

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU2208171 True 362 lncRNA 0.45 1 37971150 37971511

Neighbor


gene id symbol gene type direction distance location
tgfb1a tgfb1b coding downstream 55134 37873005 ~ 37916016 (-)
LOC110503255 LOC106613338 coding downstream 252878 37679493 ~ 37718272 (-)
LOC118944019 NA coding downstream 278920 37689230 ~ 37692230 (-)
LOC110503256 LOC106613340 coding downstream 292060 37664514 ~ 37679090 (-)
wdr62 LOC106613339 coding downstream 306861 37599847 ~ 37664289 (-)
LOC118944103 LOC106613334 coding upstream 12608 37984081 ~ 38021354 (-)
LOC118944071 leg4 coding upstream 154855 38126366 ~ 38168485 (-)
LOC110503258 LOC105027022 coding upstream 212670 38184181 ~ 38196994 (-)
ryr1b LOC103368738 coding upstream 231229 38202740 ~ 38436340 (-)
hnrnpul1 LOC105027039 coding upstream 559917 38531428 ~ 38570785 (-)
G1930601 NA non-coding downstream 24783 37946132 ~ 37946367 (-)
G1930593 NA non-coding downstream 56670 37913804 ~ 37914480 (-)
G1930587 NA non-coding downstream 81537 37889246 ~ 37889613 (-)
G1930567 NA non-coding downstream 125229 37843085 ~ 37845921 (-)
G1930548 NA non-coding downstream 154173 37816639 ~ 37816977 (-)
G1930614 NA non-coding upstream 10211 37981722 ~ 37982264 (-)
G1930615 NA non-coding upstream 11383 37982894 ~ 38072900 (-)
G1930654 NA non-coding upstream 105073 38076584 ~ 38126994 (-)
G1930682 NA non-coding upstream 143176 38114687 ~ 38115149 (-)
G1930391 LOC103149469 other downstream 666685 37304014 ~ 37304465 (-)
G1930343 NA other downstream 753084 37216638 ~ 37218332 (-)
G1930333 NA other downstream 769227 37201438 ~ 37201923 (-)
G1930026 LOC106613311 other downstream 1413266 36554184 ~ 36557884 (-)
G1927929 NA other downstream 2180565 35789266 ~ 35790585 (-)
G1930684 NA other upstream 146313 38117824 ~ 38118432 (-)
G1930800 NA other upstream 501519 38473030 ~ 38474008 (-)
G1930841 NA other upstream 608906 38580417 ~ 38582296 (-)
G1930859 NA other upstream 681040 38616137 ~ 38656202 (-)

Expression


G1930610 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 1.
End of interactive chart.

G1930610 Expression in each Bioproject

Bar chart with 7 bars.
G1930610 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 1.5.
End of interactive chart.

Co-expression Network