G1931691



Basic Information


Item Value
gene id G1931691
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048588.1
NCBI id CM023242.2
chromosome length 45930806
location 40359463 ~ 40362079 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU2209627
CCATTATACATCATGATCAGTGTCTCTTTCTGATAGGTCCCCATTATACATCATGATCAGTGTCTCTTTCTGATAGGTCCCCATTATACATCACGATCAGTGTCTCTTTCTGATAGGTCCCCATTATACATCACGATCAGTGTCTCTTTCTGATAGGTCCCCATTATACATCATGATCAGTGTCTCTTTCTGATAGGTCCCCATTATACATCATGATCAGTGTCTCTTTCTGATAGGTCCCCATTATACATCATGATCAGTGTCTCTTTCTGATAGGTCCCCATCATACATCATGATCAGTGTCTCTTTCTGATAGGTCCCCATTATACATCATGATCAGTGTCTGCTTCTGATAGGTCCCCATTACACATCATGAT
>TU2209628
TGTCTCTTTCTGATAGGTCCCCATTATACATCATGATCAGTGTCTCTTTCTGATAGGTACCCATTATACATCCTGACCCTGCTCTGTTTCTGATAGGTCCCCATTATACATCATGATCAGTGTCTCTTTCTGATAGGTCCCCATTATACATCATGATCAGTGTCTCTTTCTGATAGGTCCCCATCATACATCATGATCAGTGTCTCTTTCTGATAGGTCCCC
>TU2209624
ATTATACATCATGATCAGTGTCTCTTTCTGATAGGTCCCCATCATACATCATGATCAGTGTCTCTTTCTGATAGGTCCCCATCATACATCATGATCAGTGTCTCTTTCTGATAGGTCCCCATTATACATCACGATCAGTGTCTCTTTCTGATAGGTCCCCATTATACATCACGATCAGTGTCTCTTTCTGATAGGTCCCCATTATACATCACGATCAGTGTCTCTTTCTGATAGGTCCCCATTATACATCACGATCAGTGTCTCTTTCTGATAGGTCCCCATTATACATCACGATCATTCTC
>TU2209625
ATACATCATGATCAGTGTCTCTTTCTGATAGGTCCCCATCATACATCATGATCAGTGTCTCTTTCTGATAGGTCCCCATTATACATCACGATCAGTGTCTCTTTCTGATAGGTCCCCATTATACATCACGATCAGTGTCTCTTTCTGATAGGTCCCCATTATACATCATGATCAGTGTCTCTTTCTGATAGGTCCCCATTATACATCACGATCATTCT

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU2209627 False 377 lncRNA 0.41 4 40359463 40362079
TU2209628 False 222 lncRNA 0.42 3 40359603 40361024
TU2209624 False 302 lncRNA 0.41 2 40359745 40360246
TU2209625 True 218 lncRNA 0.41 2 40360068 40361645
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110503199 LOC106613203 coding upstream 549715 39800737 ~ 39809748 (+)
trnat-agu-148 NA coding upstream 594731 39764659 ~ 39764732 (+)
LOC110503201 NA coding upstream 727084 39630663 ~ 39632379 (+)
LOC110503405 NA coding upstream 730252 39396023 ~ 39629211 (+)
LOC110516717 LOC106581405 coding upstream 1009082 39238180 ~ 39350381 (+)
LOC110503406 LOC106581179 coding downstream 81691 40443770 ~ 40535727 (+)
LOC110503211 LOC106613213 coding downstream 448099 40810178 ~ 40837501 (+)
LOC110503202 LOC106613212 coding downstream 600363 40962442 ~ 40972379 (+)
si LOC106613210 coding downstream 650599 41012678 ~ 41125378 (+)
LOC118944044 NA coding downstream 904688 41266767 ~ 41267279 (+)
G1931638 NA non-coding upstream 79219 40280037 ~ 40280244 (+)
G1931550 NA non-coding upstream 165603 40193641 ~ 40193860 (+)
G1931548 NA non-coding upstream 166034 40193006 ~ 40193429 (+)
G1931546 NA non-coding upstream 166535 40191887 ~ 40192928 (+)
G1931545 NA non-coding upstream 168409 40190449 ~ 40191054 (+)
G1931698 NA non-coding downstream 944 40363023 ~ 40363385 (+)
G1931754 LOC105030512 non-coding downstream 73551 40435630 ~ 40435853 (+)
G1931778 NA non-coding downstream 99831 40461910 ~ 40462122 (+)
G1931789 NA non-coding downstream 107803 40469882 ~ 40470094 (+)
G1931790 NA non-coding downstream 108347 40470426 ~ 40470679 (+)
G1929916 NA other upstream 253931 40089400 ~ 40105532 (+)
G1929909 NA other upstream 281131 40076476 ~ 40078332 (+)
G1929901 NA other upstream 307113 40049364 ~ 40082173 (+)
G1929891 NA other upstream 330946 40025935 ~ 40028517 (+)
G1929816 NA other upstream 470308 39888327 ~ 39889155 (+)
G1931869 NA other downstream 199133 40561212 ~ 40561906 (+)
G1932319 NA other downstream 752558 41114637 ~ 41117412 (+)
G1932564 NA other downstream 967971 41330050 ~ 41338188 (+)
LOC110503413 LOC106613251 other downstream 1932769 42140069 ~ 42335470 (+)
G1933231 LOC106581444 other downstream 1999177 42361256 ~ 42365260 (+)

Expression


G1931691 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 20.
End of interactive chart.

G1931691 Expression in each Bioproject

Bar chart with 9 bars.
G1931691 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 350.
End of interactive chart.

Co-expression Network